ID: 942320549

View in Genome Browser
Species Human (GRCh38)
Location 2:174732198-174732220
Sequence CCTTGTCACCAGAAACTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942320543_942320549 -7 Left 942320543 2:174732182-174732204 CCTTTTAGGGTCCCTCCCTTGTC No data
Right 942320549 2:174732198-174732220 CCTTGTCACCAGAAACTGTAGGG No data
942320538_942320549 22 Left 942320538 2:174732153-174732175 CCAAGCTGCAGAGCTAGTGGGCA No data
Right 942320549 2:174732198-174732220 CCTTGTCACCAGAAACTGTAGGG No data
942320542_942320549 -3 Left 942320542 2:174732178-174732200 CCTGCCTTTTAGGGTCCCTCCCT No data
Right 942320549 2:174732198-174732220 CCTTGTCACCAGAAACTGTAGGG No data
942320541_942320549 -2 Left 942320541 2:174732177-174732199 CCCTGCCTTTTAGGGTCCCTCCC No data
Right 942320549 2:174732198-174732220 CCTTGTCACCAGAAACTGTAGGG No data
942320535_942320549 28 Left 942320535 2:174732147-174732169 CCATCTCCAAGCTGCAGAGCTAG No data
Right 942320549 2:174732198-174732220 CCTTGTCACCAGAAACTGTAGGG No data
942320534_942320549 29 Left 942320534 2:174732146-174732168 CCCATCTCCAAGCTGCAGAGCTA No data
Right 942320549 2:174732198-174732220 CCTTGTCACCAGAAACTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942320549 Original CRISPR CCTTGTCACCAGAAACTGTA GGG Intergenic
No off target data available for this crispr