ID: 942320680

View in Genome Browser
Species Human (GRCh38)
Location 2:174733040-174733062
Sequence GGGTGATCCCCGACTTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942320680_942320683 -7 Left 942320680 2:174733040-174733062 CCACCTGAAGTCGGGGATCACCC No data
Right 942320683 2:174733056-174733078 ATCACCCCCGTCTTCCCTCTGGG No data
942320680_942320682 -8 Left 942320680 2:174733040-174733062 CCACCTGAAGTCGGGGATCACCC No data
Right 942320682 2:174733055-174733077 GATCACCCCCGTCTTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942320680 Original CRISPR GGGTGATCCCCGACTTCAGG TGG (reversed) Intergenic
No off target data available for this crispr