ID: 942323202

View in Genome Browser
Species Human (GRCh38)
Location 2:174753837-174753859
Sequence CTGTGGGTCACACACCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942323199_942323202 -8 Left 942323199 2:174753822-174753844 CCACAGATTCCAGCTCTGTGGGT 0: 1
1: 0
2: 2
3: 24
4: 339
Right 942323202 2:174753837-174753859 CTGTGGGTCACACACCCAGGAGG 0: 1
1: 0
2: 3
3: 28
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942323202 Original CRISPR CTGTGGGTCACACACCCAGG AGG Intronic
902214698 1:14927017-14927039 CCCTGGGTCACGCACCCTGGAGG - Intronic
903027052 1:20436859-20436881 CTGTGGGCCTCACACACAGTAGG - Intergenic
903067812 1:20710631-20710653 CTGTGGGTCAGAGCCACAGGAGG + Intronic
904413824 1:30342783-30342805 CCAGGGGTCCCACACCCAGGAGG + Intergenic
905092529 1:35440955-35440977 CTGTTAGTGACACACTCAGGAGG + Intronic
906653694 1:47533064-47533086 CTGTGGGTCACAGCCTCATGTGG - Intergenic
908028834 1:59978315-59978337 CTGTTTGTCACACATCAAGGAGG - Intergenic
913473587 1:119215192-119215214 TGGTGGGTCCCACACCCACGGGG - Intergenic
915089786 1:153416386-153416408 GTGTGTGGGACACACCCAGGAGG - Intergenic
916556587 1:165899129-165899151 CTGGAGGTCACATGCCCAGGAGG - Intronic
917796853 1:178538807-178538829 CTGTGGGAGCCACGCCCAGGTGG - Intronic
920248462 1:204605961-204605983 CTGCTGGCCACACACCCAGATGG + Intergenic
920525534 1:206663440-206663462 ATGTGGGTTGAACACCCAGGAGG + Intronic
921225417 1:213015169-213015191 GTGTGTGGCACACGCCCAGGAGG - Intronic
924708854 1:246518460-246518482 CTGTGGGGCAGACTCCCAGGAGG + Intergenic
1062795763 10:343965-343987 CTGTGGGTCACAAAGCCAGCGGG + Intronic
1063134561 10:3205642-3205664 TTGTTGGTCACACACCCTAGTGG - Intergenic
1063277848 10:4590719-4590741 ATGTGGATCTAACACCCAGGAGG + Intergenic
1064034691 10:11905830-11905852 CTCTGGGACAAACACCCAAGAGG - Intergenic
1066806372 10:39259648-39259670 CTGAGGGTCCCACACCCACAGGG + Intergenic
1067568365 10:47353956-47353978 ATGTGAGGCACACTCCCAGGTGG - Intronic
1067804708 10:49384717-49384739 TTGTGGCTCCCACACCCTGGGGG - Intronic
1067877749 10:50020086-50020108 CTTTGGGTCACAAACACAAGTGG - Intergenic
1067877767 10:50020153-50020175 CTTTGGGTCACAAACACAAGTGG - Intergenic
1069625845 10:69867230-69867252 CTGTGGGTGGCAGACCCTGGAGG + Intronic
1070318483 10:75336616-75336638 CTGTGGGTCAGATGTCCAGGTGG + Intergenic
1070519417 10:77238869-77238891 TTGTGGGTCAAACACCCATTTGG - Intronic
1070698327 10:78579754-78579776 CTGCGGGTCCCACATCCAGGAGG + Intergenic
1070795968 10:79216418-79216440 CTGTGGGTCCCAGAGCCTGGTGG - Intronic
1071270170 10:83999912-83999934 CTGGGGGACACACAACCATGAGG - Intergenic
1071713908 10:88076103-88076125 GTGTGGGTCACACTCCCACTTGG + Intergenic
1072683273 10:97521772-97521794 GAGTGGGTCACACACCCACCTGG + Intronic
1075410858 10:122226952-122226974 CTTCAGGTCACACAACCAGGAGG - Intronic
1076637212 10:131889890-131889912 TGGTGAGACACACACCCAGGGGG + Intergenic
1076657311 10:132033296-132033318 CTGTGAGTCCAACTCCCAGGGGG + Intergenic
1076660933 10:132055776-132055798 CAGTGGGACACAAACCCCGGGGG - Intergenic
1076898287 10:133324972-133324994 CTGTGGGCCACACATCTAGGAGG + Intronic
1077024480 11:433143-433165 CTGAGGCTCACACAGCCAGTGGG + Intronic
1077286027 11:1766338-1766360 CTCTGGAGCACACAGCCAGGCGG + Intergenic
1077351878 11:2096874-2096896 CTGTGGGGCAGACAGCCTGGGGG - Intergenic
1080667296 11:34346852-34346874 CTGAGGCTCACACACCAAGTGGG - Intronic
1083674811 11:64319315-64319337 CTGAGGGTCCCACCCTCAGGAGG - Intronic
1084605499 11:70169555-70169577 CTGTGGGTCACTCAGCAGGGTGG - Intronic
1084670583 11:70604366-70604388 CTGTGGGGCACACAGCTACGTGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1089619923 11:119716256-119716278 CTGGGGCACACACAGCCAGGAGG + Intronic
1091024019 11:132126106-132126128 CACTCGTTCACACACCCAGGTGG - Intronic
1092793788 12:12091473-12091495 CTGTGGGTTATGGACCCAGGAGG - Intronic
1094368910 12:29714659-29714681 CTGTGGTCCACAAATCCAGGGGG - Intronic
1095579200 12:43776678-43776700 CGGTAGGTCACATATCCAGGAGG + Intronic
1095942244 12:47734975-47734997 CTGTGGGGTACACACCAGGGAGG - Intronic
1096498123 12:52050419-52050441 CTGAAGGTCACACAGCCAGGTGG - Intronic
1098861356 12:75714245-75714267 CTGTGGGTCACAAACCCCTGCGG + Intergenic
1102238793 12:111310789-111310811 CCCTGGGTCACACAGCCAGGTGG - Intronic
1102524294 12:113500289-113500311 ATGGAGGACACACACCCAGGAGG - Intergenic
1103985011 12:124761121-124761143 GCATGGGTCACACAGCCAGGAGG - Intergenic
1104193949 12:126512731-126512753 CTGTGGGTCACACTCAAATGGGG + Intergenic
1104278038 12:127348025-127348047 CTGTTGGCCACAGACTCAGGGGG + Intergenic
1104708876 12:130970799-130970821 CTGTGGGTGACAAGCCCAGCTGG - Intronic
1104892546 12:132147513-132147535 CTGTGGCCCACCCAACCAGGAGG + Intronic
1107307049 13:39033561-39033583 ATGTGTGTCACACACACAAGGGG - Intronic
1107441201 13:40428846-40428868 CATTGAGTCACACACCCTGGAGG + Intergenic
1109858879 13:68171340-68171362 CAGTGGATCCCACACCCGGGCGG - Intergenic
1111247767 13:85563346-85563368 CTGTGAGTGACAGACCCAGGAGG - Intergenic
1113842130 13:113366221-113366243 CTGAGGGACACAGTCCCAGGTGG - Intergenic
1113964162 13:114143028-114143050 CTGAGGGGCACAGACACAGGTGG - Intergenic
1114669182 14:24399711-24399733 ATGGGGGACACACACCGAGGAGG - Intronic
1116342743 14:43745995-43746017 CTGTGGGTCACACACAGAAGTGG - Intergenic
1118710154 14:68512206-68512228 CTTTGGGCCACACTGCCAGGTGG - Intronic
1119780424 14:77273335-77273357 CTGTGGGTCATCCGCCCAGGAGG + Intergenic
1122312156 14:100804221-100804243 CTGTGGGCCACACCACCGGGTGG + Intergenic
1122672256 14:103381873-103381895 TTGTAATTCACACACCCAGGTGG + Intergenic
1123133462 14:106006916-106006938 CTGTGGCTGACCCTCCCAGGGGG - Intergenic
1127668256 15:61170041-61170063 CCTTGGGTCACACAGCTAGGAGG - Intronic
1129360221 15:75019806-75019828 CTGGGGGTCAGGTACCCAGGTGG - Exonic
1130094738 15:80847545-80847567 CTGGGGGTCCTACTCCCAGGTGG - Intronic
1130283360 15:82536193-82536215 CTGTGAGACACACACACACGTGG + Intergenic
1131249428 15:90820675-90820697 CTGGGGCTCATACAGCCAGGTGG - Intergenic
1132342555 15:101087583-101087605 CTGTGGGTCACCCAGCCAGGAGG - Intergenic
1132873092 16:2124283-2124305 CTGGGGTTCACACGCCCGGGTGG - Intronic
1132904551 16:2275850-2275872 CTGTGGGTCACACGCGCGAGCGG - Intergenic
1134552181 16:15143464-15143486 CTGGGGTTCACACGCCCGGGTGG - Intergenic
1138926040 16:61592599-61592621 GTGTGGGTCACAGATCCAGGTGG - Intergenic
1140280891 16:73554708-73554730 CGGTGGCTGACACACTCAGGAGG + Intergenic
1143204397 17:5132221-5132243 CTGTGGCTCTGACTCCCAGGAGG - Intronic
1144875469 17:18394909-18394931 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1145156756 17:20549512-20549534 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1145798934 17:27671396-27671418 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1146160143 17:30555217-30555239 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1146591758 17:34133502-34133524 CTGTGGGACAGAAGCCCAGGAGG + Intronic
1146844267 17:36173600-36173622 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146856572 17:36261535-36261557 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146864045 17:36326840-36326862 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1146879840 17:36436531-36436553 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147066905 17:37927428-37927450 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1147075366 17:37986070-37986092 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147078437 17:38006989-38007011 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1147086891 17:38065616-38065638 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147094375 17:38130924-38130946 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1147102836 17:38189579-38189601 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1149847410 17:60016046-60016068 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1149866750 17:60155249-60155271 TTGTTGCTCACACACACAGGAGG - Intronic
1150085768 17:62272663-62272685 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1151411088 17:73930210-73930232 CTGTGGCTCCCACAGCCAGTAGG - Intergenic
1152339478 17:79716286-79716308 GTGTGGGGCTGACACCCAGGAGG + Intergenic
1152417211 17:80170501-80170523 CAGAGGGTCACAAGCCCAGGAGG - Intronic
1153928467 18:9856761-9856783 CAGTGTGTAACACACTCAGGAGG + Intronic
1154215740 18:12414821-12414843 ATTTGGGCCACACACCCTGGTGG - Intronic
1155169132 18:23254241-23254263 CTGTGGGTCACACTGCCTGGGGG - Intronic
1157599792 18:48886906-48886928 CTGCAGGACACACAGCCAGGGGG + Intergenic
1157856070 18:51106885-51106907 CTGTGGTCCTCACTCCCAGGAGG + Intergenic
1158401069 18:57121982-57122004 CTGTGGGTCTTTCACCCAGCTGG - Intergenic
1160607052 18:80059176-80059198 ATGTGGGTCACACACCACAGGGG - Intronic
1161296979 19:3525091-3525113 ATGAGGGCCACACTCCCAGGTGG + Intronic
1161431765 19:4236672-4236694 CTGTGGATGTCTCACCCAGGAGG - Intronic
1161758434 19:6152168-6152190 CTGAGGCTCACACAGCCAGTGGG + Intronic
1162019167 19:7860918-7860940 CTGGGGGAAACACACACAGGTGG - Intronic
1162278236 19:9675185-9675207 CTGTCCGGCACCCACCCAGGAGG - Intergenic
1162369426 19:10270066-10270088 CTTGGGGTCACACGCACAGGCGG + Intergenic
1162494256 19:11014275-11014297 CCATGGGTCACACACCCATAGGG + Intronic
1163519995 19:17786479-17786501 GTTGGGGTCACACAGCCAGGAGG + Intronic
1163671216 19:18629806-18629828 CTGTGTCCCACACACCAAGGAGG + Intergenic
1163839386 19:19596825-19596847 GTGAGGATCACCCACCCAGGAGG + Intronic
1164501389 19:28823266-28823288 CTGTATGTGACACACCCAGAGGG - Intergenic
1164543352 19:29139178-29139200 GTGTTGGTCACAGGCCCAGGTGG - Intergenic
1164600731 19:29561686-29561708 CTGTGGGTGAAGTACCCAGGAGG + Intronic
1164654969 19:29914134-29914156 TTTTGGCTCAGACACCCAGGTGG + Intergenic
1165605737 19:37102162-37102184 CGGTGGGAGACACACCCATGTGG - Intronic
1165848849 19:38837251-38837273 CTGTTGGTGACACAGGCAGGTGG - Intronic
1167173495 19:47849301-47849323 CTGGGGGTCACACCGCAAGGGGG + Intergenic
1168134650 19:54342221-54342243 TGGTGGGTTACACACCCTGGTGG - Intergenic
1168278994 19:55294000-55294022 CTGTGGCTGAGACAGCCAGGTGG - Exonic
925977320 2:9150424-9150446 CCCAGGGTCACACAGCCAGGTGG + Intergenic
927068357 2:19496811-19496833 CTGTTGACCACACACCCAGGTGG + Intergenic
927958451 2:27224512-27224534 TTGAGGGTCACACGCCCAGAAGG - Intronic
931134309 2:59378641-59378663 CTTTGGGTGAGACCCCCAGGTGG - Intergenic
931809205 2:65838072-65838094 CTGTGGGTGGTACACCCAGTAGG - Intergenic
931999263 2:67868980-67869002 CTGTGGACCACACAGCAAGGAGG + Intergenic
937440321 2:121909714-121909736 CTCTGGGCCACACACTCTGGAGG + Intergenic
937990972 2:127662151-127662173 CTGCAGGTCACACAGACAGGGGG - Intronic
940200137 2:151141389-151141411 CTGTCAGTCCCAAACCCAGGTGG + Intergenic
940653258 2:156458266-156458288 CTTTAGTTAACACACCCAGGGGG - Intronic
942323202 2:174753837-174753859 CTGTGGGTCACACACCCAGGAGG + Intronic
942477728 2:176345740-176345762 CTGGGGGTCACAGACACAAGGGG - Intergenic
942551572 2:177125284-177125306 CTCTAGGACACACACCCATGGGG + Intergenic
944479935 2:200145978-200146000 CTGTGGAACTCACACTCAGGTGG + Intergenic
946170094 2:217889995-217890017 CAGTGGGTCACACAACCAGGAGG + Intronic
948128052 2:235579385-235579407 CTGTGGGTTGCAATCCCAGGGGG + Intronic
948802577 2:240439580-240439602 CTGTGTGCCAACCACCCAGGCGG - Intronic
1170152185 20:13237231-13237253 CTGTTGGGCACATACTCAGGTGG - Intronic
1171399277 20:24861191-24861213 CTGTGGCTCTCACACCCATCTGG - Intergenic
1173300554 20:41798642-41798664 CTGAGCCTCACACACCCAGAAGG + Intergenic
1173578795 20:44131771-44131793 CTGTTGATCACACTCCCAGAAGG - Intronic
1175331740 20:58169303-58169325 CTGTGGGTCAGAAATCCAGATGG - Intergenic
1175575628 20:60058510-60058532 CTGTGGGCCCCTCTCCCAGGAGG + Intronic
1175596906 20:60242344-60242366 CTGTGGGTCCCACCCACAGATGG + Intergenic
1176088246 20:63307678-63307700 CTGTGGGGACCACACCCGGGTGG - Intronic
1178165477 21:29970257-29970279 GTTAAGGTCACACACCCAGGAGG - Intergenic
1180021949 21:45134072-45134094 CTGTCGGGCACACACCCGGCGGG - Intronic
1180021969 21:45134159-45134181 CTGTTGGGCACACACCCAGCGGG - Intronic
1180021983 21:45134229-45134251 CTGTCGGGCACACACCCGGCGGG - Intronic
1180022003 21:45134316-45134338 CTGTCGGGCACACACCCGGCGGG - Intronic
1181044857 22:20209700-20209722 CTGTGGACCACCTACCCAGGTGG + Intergenic
1181343128 22:22198708-22198730 ATGTGGACCACAGACCCAGGAGG - Intergenic
1181667369 22:24407416-24407438 CTGGGGTTCCCACAGCCAGGCGG + Intronic
1183935161 22:41257815-41257837 CCATGGGGCACACACCCAGGGGG + Intronic
1184253154 22:43272229-43272251 TGCTGGGTCACACACCCAGCTGG - Intronic
950503605 3:13379372-13379394 CTGTGGGTGACTCACCCCAGAGG - Intronic
950637284 3:14324008-14324030 CTGTGGGTCACACAGAAAGTGGG + Intergenic
950673596 3:14541254-14541276 CTGAGGGTCAGACACCAAGAAGG + Intronic
950883769 3:16345216-16345238 CTGTGGGCCAGAAATCCAGGTGG - Intronic
951896851 3:27617742-27617764 ATGAGGGCCACACAGCCAGGAGG + Intergenic
953376549 3:42433051-42433073 CTCTGATTCCCACACCCAGGTGG - Intergenic
954811513 3:53251177-53251199 CTGTGGGTCAGAAACCCTGGGGG + Intronic
955183244 3:56691367-56691389 TTGTAGGTCACACAGCTAGGAGG + Intergenic
955750373 3:62180432-62180454 CTGTGGTTCAGACACTCAGTTGG + Intronic
957560724 3:81817183-81817205 CTGTGGGTTACACAAGCACGTGG + Intergenic
961175328 3:124830625-124830647 GTGTGGGCCCCATACCCAGGTGG - Intronic
961243673 3:125433699-125433721 CTCTGGGTCACACAGACAGATGG - Intergenic
961334276 3:126160838-126160860 CATTGGCTCACTCACCCAGGGGG + Exonic
961361883 3:126373253-126373275 CTTTTGGTAACACACCCAGGAGG - Intergenic
961424268 3:126832750-126832772 CTCTGGGTCAGACCACCAGGAGG - Intronic
961537950 3:127581255-127581277 CTGTGGATGACAGCCCCAGGCGG + Intronic
961627170 3:128272126-128272148 GTGTGGGCCACACACTCAGGTGG + Intronic
961854695 3:129857975-129857997 CTGAAGGTCACACAGCCAGCAGG + Intronic
964094505 3:152915930-152915952 CTGTGAGTCACTCACCTTGGAGG - Intergenic
965401865 3:168222075-168222097 CTCTGGGTTGCAAACCCAGGAGG + Intergenic
965793579 3:172414479-172414501 CAGTAGGTCAGACACCAAGGAGG + Intergenic
968611497 4:1559180-1559202 CTGAGGGTGTCACACCAAGGGGG + Intergenic
969310350 4:6349304-6349326 CTCAGGGTCACACAGCCAGGAGG - Intronic
969480575 4:7444974-7444996 CTGTGGTTGCAACACCCAGGTGG + Intronic
969537290 4:7764295-7764317 CTGTGGGACACACAGACAGGAGG + Intronic
969844103 4:9905894-9905916 CTCTGGGTCACACAGTCAGCTGG - Intronic
970460252 4:16268093-16268115 CTGTGGGTCACTAATCCAGAAGG + Intergenic
970569615 4:17366853-17366875 CTATGGGTCAGGAACCCAGGCGG - Intergenic
976672125 4:87665531-87665553 CTGTGCCTCAGGCACCCAGGAGG - Intergenic
980908869 4:138975880-138975902 CTGTGTGACACAGTCCCAGGAGG - Intergenic
985344588 4:188989549-188989571 CTGTGGGTTACACGCCCAGGTGG - Intergenic
985581297 5:696476-696498 CTGTGGGACACACCCCTACGGGG - Intergenic
985595926 5:787808-787830 CTGTGGGACACACCCCCACGGGG - Intergenic
990258990 5:54000878-54000900 CAGTGGCTCACACACTCATGAGG - Intronic
992853357 5:80834216-80834238 CTGTGGGACTCACACCCTGGAGG - Intronic
996215023 5:120856009-120856031 CTGGTGGGCACACACACAGGTGG + Intergenic
998533570 5:142908270-142908292 CTGTGGGTCACGAATTCAGGGGG + Intronic
999274297 5:150318799-150318821 CTGTGGATGACACAGCAAGGAGG + Intronic
1005200488 6:23339230-23339252 CTATGGGTCAGAAATCCAGGAGG + Intergenic
1005850463 6:29816999-29817021 TTGTGGGTCACACAGCCACTTGG - Intergenic
1005857309 6:29872409-29872431 CTGTGGGTCACACAGGCACTTGG - Intergenic
1005918964 6:30381806-30381828 CTGAGTGTCCCACACCCATGGGG - Intergenic
1006296728 6:33173159-33173181 CTGTGGGGCAGATTCCCAGGAGG + Intronic
1008562409 6:52735765-52735787 GTGTGGGTCAGCCACCCAGGTGG - Intergenic
1012814700 6:104008480-104008502 CTGAGGGTCACACAGTCAGTAGG - Intergenic
1013462520 6:110388717-110388739 CTCTGGGTCACAGACACAGCAGG + Intergenic
1013747222 6:113359753-113359775 ATCTGGGACACAGACCCAGGAGG - Intergenic
1014370090 6:120595508-120595530 CTGTGGGTCAGACACTCTGCGGG + Intergenic
1019160009 6:170063306-170063328 CAGTGGATCACAGGCCCAGGTGG + Intergenic
1019308832 7:349082-349104 CTGTGGGACAAGCACCCAGCGGG - Intergenic
1019769124 7:2872266-2872288 CTCTGAGTCCCACACCCAGACGG + Intergenic
1019870642 7:3757688-3757710 CTGTGTGTCCAACACCCCGGAGG + Intronic
1021967842 7:25939287-25939309 CTGGGGCACACCCACCCAGGGGG - Intergenic
1023454174 7:40320665-40320687 GTGTGGGTCACAAACAAAGGAGG - Intronic
1024029510 7:45446353-45446375 GTGTGGGTCACAGGTCCAGGTGG - Intergenic
1026451091 7:70530324-70530346 CTATCTGTCACACTCCCAGGAGG - Intronic
1027860377 7:83570979-83571001 CCCTGGTTCACACAACCAGGAGG - Intronic
1028747515 7:94344579-94344601 GTGTGGGCCACGCACCCAGCAGG + Intergenic
1033690563 7:143732596-143732618 ATTTGGGTCACACACAAAGGTGG + Intergenic
1036257686 8:7218668-7218690 CTGTGGGTCAGACACACACTGGG + Intergenic
1036258937 8:7225667-7225689 CTGTGGGTCAGACACACACTGGG + Intergenic
1036307684 8:7613843-7613865 CTGTGGGTCAGACACACACTGGG - Intergenic
1036310990 8:7684263-7684285 CTGTGGGTCAGACACACACTGGG + Intergenic
1036892421 8:12605108-12605130 CTGTGGGTCAGACACACACTGGG + Intergenic
1038318413 8:26507635-26507657 CTGTGGGTCCTGCCCCCAGGTGG + Exonic
1038493408 8:27985640-27985662 CAGAGGGTCACATACCCAGGAGG + Intronic
1041169193 8:55123723-55123745 CTGTGGGACACACACACAGCAGG - Intronic
1041278754 8:56190452-56190474 CTGCATGTCACACAACCAGGAGG - Intronic
1042370872 8:67989077-67989099 CTGGGGGTCACATACTCAGATGG - Intronic
1043012178 8:74894584-74894606 AAGTGGGTCACACATCCAGAGGG - Intergenic
1045393596 8:101738733-101738755 CTCAGGGTCACACAGCCACGAGG - Intronic
1045479715 8:102582294-102582316 CTGTGCGTCACACTCCTGGGGGG + Intergenic
1047098450 8:121649661-121649683 CTGTTGTTCACACACACAGGTGG + Intergenic
1047641347 8:126824877-126824899 CAGGGGGATACACACCCAGGAGG - Intergenic
1048370274 8:133771105-133771127 CTTTGGGGCACCCACCCAGCTGG - Intergenic
1049097716 8:140558697-140558719 CTGTGGGTCACCCTCCCTAGGGG - Intronic
1049246987 8:141568114-141568136 CTGCAAGTCACACAGCCAGGAGG - Intergenic
1049530911 8:143154537-143154559 CTGAGGGGCCCACAGCCAGGTGG + Intergenic
1053273394 9:36765684-36765706 CTGTGGGACAAGCATCCAGGAGG + Intergenic
1056786826 9:89598519-89598541 CTCAAGGTCACACAGCCAGGAGG - Intergenic
1060028859 9:120197054-120197076 CTGTAGGTCCTACAACCAGGAGG + Intergenic
1060459460 9:123836009-123836031 CTGTGTGTCAGACACCCTGCTGG - Intronic
1061795188 9:133082142-133082164 CTGTGGGCCCCCCACCCAAGTGG - Intronic
1062136603 9:134932032-134932054 CTGTGGGTCACAGACACGGGAGG - Intergenic
1190157323 X:48004529-48004551 ATGTGGGACACACACACCGGGGG + Intronic
1190173093 X:48127414-48127436 ATGTGGGACACACACACCGGGGG + Intergenic
1202264296 Y:23001741-23001763 CTCTCGATTACACACCCAGGTGG + Intronic
1202417287 Y:24635483-24635505 CTCTCGATTACACACCCAGGTGG + Intronic
1202453499 Y:25034603-25034625 CTCTCGATTACACACCCAGGTGG - Intronic