ID: 942323737

View in Genome Browser
Species Human (GRCh38)
Location 2:174757908-174757930
Sequence CCCCTCACGGGATTGTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 12, 3: 72, 4: 641}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942323737_942323744 19 Left 942323737 2:174757908-174757930 CCTCACAACAATCCCGTGAGGGG 0: 1
1: 0
2: 12
3: 72
4: 641
Right 942323744 2:174757950-174757972 TTCTGCAGATGAGAAAACAAAGG 0: 1
1: 12
2: 98
3: 728
4: 3619

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942323737 Original CRISPR CCCCTCACGGGATTGTTGTG AGG (reversed) Intronic