ID: 942323737 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:174757908-174757930 |
| Sequence | CCCCTCACGGGATTGTTGTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 726 | |||
| Summary | {0: 1, 1: 0, 2: 12, 3: 72, 4: 641} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942323737_942323744 | 19 | Left | 942323737 | 2:174757908-174757930 | CCTCACAACAATCCCGTGAGGGG | 0: 1 1: 0 2: 12 3: 72 4: 641 |
||
| Right | 942323744 | 2:174757950-174757972 | TTCTGCAGATGAGAAAACAAAGG | 0: 1 1: 12 2: 98 3: 728 4: 3619 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942323737 | Original CRISPR | CCCCTCACGGGATTGTTGTG AGG (reversed) | Intronic | ||