ID: 942323744

View in Genome Browser
Species Human (GRCh38)
Location 2:174757950-174757972
Sequence TTCTGCAGATGAGAAAACAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4458
Summary {0: 1, 1: 12, 2: 98, 3: 728, 4: 3619}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942323741_942323744 7 Left 942323741 2:174757920-174757942 CCCGTGAGGGGAGGGTGATTACT 0: 1
1: 0
2: 0
3: 7
4: 139
Right 942323744 2:174757950-174757972 TTCTGCAGATGAGAAAACAAAGG 0: 1
1: 12
2: 98
3: 728
4: 3619
942323742_942323744 6 Left 942323742 2:174757921-174757943 CCGTGAGGGGAGGGTGATTACTG 0: 1
1: 0
2: 0
3: 8
4: 130
Right 942323744 2:174757950-174757972 TTCTGCAGATGAGAAAACAAAGG 0: 1
1: 12
2: 98
3: 728
4: 3619
942323737_942323744 19 Left 942323737 2:174757908-174757930 CCTCACAACAATCCCGTGAGGGG 0: 1
1: 0
2: 12
3: 72
4: 641
Right 942323744 2:174757950-174757972 TTCTGCAGATGAGAAAACAAAGG 0: 1
1: 12
2: 98
3: 728
4: 3619

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942323744 Original CRISPR TTCTGCAGATGAGAAAACAA AGG Exonic