ID: 942323995

View in Genome Browser
Species Human (GRCh38)
Location 2:174760078-174760100
Sequence TTAGTTATGGCCACTCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942323995_942324004 6 Left 942323995 2:174760078-174760100 CCCACTAGAGTGGCCATAACTAA No data
Right 942324004 2:174760107-174760129 GAAAATAACAAGGGTTGGGGAGG No data
942323995_942324000 -3 Left 942323995 2:174760078-174760100 CCCACTAGAGTGGCCATAACTAA No data
Right 942324000 2:174760098-174760120 TAACAAGTGGAAAATAACAAGGG No data
942323995_942324003 3 Left 942323995 2:174760078-174760100 CCCACTAGAGTGGCCATAACTAA No data
Right 942324003 2:174760104-174760126 GTGGAAAATAACAAGGGTTGGGG No data
942323995_942324002 2 Left 942323995 2:174760078-174760100 CCCACTAGAGTGGCCATAACTAA No data
Right 942324002 2:174760103-174760125 AGTGGAAAATAACAAGGGTTGGG No data
942323995_942323999 -4 Left 942323995 2:174760078-174760100 CCCACTAGAGTGGCCATAACTAA No data
Right 942323999 2:174760097-174760119 CTAACAAGTGGAAAATAACAAGG No data
942323995_942324005 21 Left 942323995 2:174760078-174760100 CCCACTAGAGTGGCCATAACTAA No data
Right 942324005 2:174760122-174760144 TGGGGAGGTTGCAGAGAAACTGG No data
942323995_942324001 1 Left 942323995 2:174760078-174760100 CCCACTAGAGTGGCCATAACTAA No data
Right 942324001 2:174760102-174760124 AAGTGGAAAATAACAAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942323995 Original CRISPR TTAGTTATGGCCACTCTAGT GGG (reversed) Intronic
No off target data available for this crispr