ID: 942326137

View in Genome Browser
Species Human (GRCh38)
Location 2:174778594-174778616
Sequence CCTAACACGCTGAAGATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942326135_942326137 19 Left 942326135 2:174778552-174778574 CCAGTGATGGTGCTGTGGTTTGC No data
Right 942326137 2:174778594-174778616 CCTAACACGCTGAAGATGAAAGG No data
942326129_942326137 28 Left 942326129 2:174778543-174778565 CCCCTCGCCCCAGTGATGGTGCT No data
Right 942326137 2:174778594-174778616 CCTAACACGCTGAAGATGAAAGG No data
942326133_942326137 21 Left 942326133 2:174778550-174778572 CCCCAGTGATGGTGCTGTGGTTT No data
Right 942326137 2:174778594-174778616 CCTAACACGCTGAAGATGAAAGG No data
942326134_942326137 20 Left 942326134 2:174778551-174778573 CCCAGTGATGGTGCTGTGGTTTG No data
Right 942326137 2:174778594-174778616 CCTAACACGCTGAAGATGAAAGG No data
942326131_942326137 26 Left 942326131 2:174778545-174778567 CCTCGCCCCAGTGATGGTGCTGT No data
Right 942326137 2:174778594-174778616 CCTAACACGCTGAAGATGAAAGG No data
942326130_942326137 27 Left 942326130 2:174778544-174778566 CCCTCGCCCCAGTGATGGTGCTG No data
Right 942326137 2:174778594-174778616 CCTAACACGCTGAAGATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942326137 Original CRISPR CCTAACACGCTGAAGATGAA AGG Intergenic
No off target data available for this crispr