ID: 942328049

View in Genome Browser
Species Human (GRCh38)
Location 2:174792076-174792098
Sequence TGCTGGGCCTGCCCTATGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942328049_942328056 -2 Left 942328049 2:174792076-174792098 CCCGGCATAGGGCAGGCCCAGCA No data
Right 942328056 2:174792097-174792119 CAGAGGCTATGCTGGTGGACTGG No data
942328049_942328057 -1 Left 942328049 2:174792076-174792098 CCCGGCATAGGGCAGGCCCAGCA No data
Right 942328057 2:174792098-174792120 AGAGGCTATGCTGGTGGACTGGG No data
942328049_942328058 0 Left 942328049 2:174792076-174792098 CCCGGCATAGGGCAGGCCCAGCA No data
Right 942328058 2:174792099-174792121 GAGGCTATGCTGGTGGACTGGGG No data
942328049_942328060 16 Left 942328049 2:174792076-174792098 CCCGGCATAGGGCAGGCCCAGCA No data
Right 942328060 2:174792115-174792137 ACTGGGGACATTCTCAGCGTGGG No data
942328049_942328054 -7 Left 942328049 2:174792076-174792098 CCCGGCATAGGGCAGGCCCAGCA No data
Right 942328054 2:174792092-174792114 CCCAGCAGAGGCTATGCTGGTGG No data
942328049_942328059 15 Left 942328049 2:174792076-174792098 CCCGGCATAGGGCAGGCCCAGCA No data
Right 942328059 2:174792114-174792136 GACTGGGGACATTCTCAGCGTGG No data
942328049_942328052 -10 Left 942328049 2:174792076-174792098 CCCGGCATAGGGCAGGCCCAGCA No data
Right 942328052 2:174792089-174792111 AGGCCCAGCAGAGGCTATGCTGG No data
942328049_942328063 25 Left 942328049 2:174792076-174792098 CCCGGCATAGGGCAGGCCCAGCA No data
Right 942328063 2:174792124-174792146 ATTCTCAGCGTGGGGAGCCTGGG No data
942328049_942328061 17 Left 942328049 2:174792076-174792098 CCCGGCATAGGGCAGGCCCAGCA No data
Right 942328061 2:174792116-174792138 CTGGGGACATTCTCAGCGTGGGG No data
942328049_942328062 24 Left 942328049 2:174792076-174792098 CCCGGCATAGGGCAGGCCCAGCA No data
Right 942328062 2:174792123-174792145 CATTCTCAGCGTGGGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942328049 Original CRISPR TGCTGGGCCTGCCCTATGCC GGG (reversed) Intergenic
No off target data available for this crispr