ID: 942328055

View in Genome Browser
Species Human (GRCh38)
Location 2:174792093-174792115
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942328055_942328061 0 Left 942328055 2:174792093-174792115 CCAGCAGAGGCTATGCTGGTGGA No data
Right 942328061 2:174792116-174792138 CTGGGGACATTCTCAGCGTGGGG No data
942328055_942328063 8 Left 942328055 2:174792093-174792115 CCAGCAGAGGCTATGCTGGTGGA No data
Right 942328063 2:174792124-174792146 ATTCTCAGCGTGGGGAGCCTGGG No data
942328055_942328060 -1 Left 942328055 2:174792093-174792115 CCAGCAGAGGCTATGCTGGTGGA No data
Right 942328060 2:174792115-174792137 ACTGGGGACATTCTCAGCGTGGG No data
942328055_942328059 -2 Left 942328055 2:174792093-174792115 CCAGCAGAGGCTATGCTGGTGGA No data
Right 942328059 2:174792114-174792136 GACTGGGGACATTCTCAGCGTGG No data
942328055_942328062 7 Left 942328055 2:174792093-174792115 CCAGCAGAGGCTATGCTGGTGGA No data
Right 942328062 2:174792123-174792145 CATTCTCAGCGTGGGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942328055 Original CRISPR TCCACCAGCATAGCCTCTGC TGG (reversed) Intergenic
No off target data available for this crispr