ID: 942328059

View in Genome Browser
Species Human (GRCh38)
Location 2:174792114-174792136
Sequence GACTGGGGACATTCTCAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942328053_942328059 -1 Left 942328053 2:174792092-174792114 CCCAGCAGAGGCTATGCTGGTGG No data
Right 942328059 2:174792114-174792136 GACTGGGGACATTCTCAGCGTGG No data
942328049_942328059 15 Left 942328049 2:174792076-174792098 CCCGGCATAGGGCAGGCCCAGCA No data
Right 942328059 2:174792114-174792136 GACTGGGGACATTCTCAGCGTGG No data
942328050_942328059 14 Left 942328050 2:174792077-174792099 CCGGCATAGGGCAGGCCCAGCAG No data
Right 942328059 2:174792114-174792136 GACTGGGGACATTCTCAGCGTGG No data
942328055_942328059 -2 Left 942328055 2:174792093-174792115 CCAGCAGAGGCTATGCTGGTGGA No data
Right 942328059 2:174792114-174792136 GACTGGGGACATTCTCAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942328059 Original CRISPR GACTGGGGACATTCTCAGCG TGG Intergenic
No off target data available for this crispr