ID: 942328062

View in Genome Browser
Species Human (GRCh38)
Location 2:174792123-174792145
Sequence CATTCTCAGCGTGGGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942328049_942328062 24 Left 942328049 2:174792076-174792098 CCCGGCATAGGGCAGGCCCAGCA No data
Right 942328062 2:174792123-174792145 CATTCTCAGCGTGGGGAGCCTGG No data
942328050_942328062 23 Left 942328050 2:174792077-174792099 CCGGCATAGGGCAGGCCCAGCAG No data
Right 942328062 2:174792123-174792145 CATTCTCAGCGTGGGGAGCCTGG No data
942328055_942328062 7 Left 942328055 2:174792093-174792115 CCAGCAGAGGCTATGCTGGTGGA No data
Right 942328062 2:174792123-174792145 CATTCTCAGCGTGGGGAGCCTGG No data
942328053_942328062 8 Left 942328053 2:174792092-174792114 CCCAGCAGAGGCTATGCTGGTGG No data
Right 942328062 2:174792123-174792145 CATTCTCAGCGTGGGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942328062 Original CRISPR CATTCTCAGCGTGGGGAGCC TGG Intergenic
No off target data available for this crispr