ID: 942334135

View in Genome Browser
Species Human (GRCh38)
Location 2:174862788-174862810
Sequence CAAGATATGAAAGGTATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942334133_942334135 4 Left 942334133 2:174862761-174862783 CCAAAAGAGAAAGTTAGGTTCAC No data
Right 942334135 2:174862788-174862810 CAAGATATGAAAGGTATTTCTGG No data
942334131_942334135 9 Left 942334131 2:174862756-174862778 CCTCTCCAAAAGAGAAAGTTAGG No data
Right 942334135 2:174862788-174862810 CAAGATATGAAAGGTATTTCTGG No data
942334130_942334135 22 Left 942334130 2:174862743-174862765 CCACATTTGAAAACCTCTCCAAA No data
Right 942334135 2:174862788-174862810 CAAGATATGAAAGGTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942334135 Original CRISPR CAAGATATGAAAGGTATTTC TGG Intronic
No off target data available for this crispr