ID: 942334890

View in Genome Browser
Species Human (GRCh38)
Location 2:174872816-174872838
Sequence GATCAGAGTAGTCCCCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942334890_942334894 25 Left 942334890 2:174872816-174872838 CCTGGTTGGGGACTACTCTGATC No data
Right 942334894 2:174872864-174872886 ATGCTTCACATTTACTAGGAAGG No data
942334890_942334893 21 Left 942334890 2:174872816-174872838 CCTGGTTGGGGACTACTCTGATC No data
Right 942334893 2:174872860-174872882 TGCAATGCTTCACATTTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942334890 Original CRISPR GATCAGAGTAGTCCCCAACC AGG (reversed) Intronic
No off target data available for this crispr