ID: 942335306

View in Genome Browser
Species Human (GRCh38)
Location 2:174878070-174878092
Sequence CGATGGCAAGCACTTTGTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942335306_942335310 -1 Left 942335306 2:174878070-174878092 CCCCAACAAAGTGCTTGCCATCG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 942335310 2:174878092-174878114 GTAGTAGAGCCTGAAGTTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 96
942335306_942335313 30 Left 942335306 2:174878070-174878092 CCCCAACAAAGTGCTTGCCATCG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 942335313 2:174878123-174878145 CCAAATCTGCCTCAATGAAATGG 0: 1
1: 0
2: 0
3: 15
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942335306 Original CRISPR CGATGGCAAGCACTTTGTTG GGG (reversed) Exonic
907037770 1:51231450-51231472 CTATGGAAAGCACTGTGATGTGG + Intergenic
907372739 1:54013785-54013807 TGAAGGCAGGCACTGTGTTGGGG + Intronic
907408100 1:54266089-54266111 CGCTGGCAAGCAGTGTGTGGAGG - Intronic
907575006 1:55518579-55518601 CCATGGAAACAACTTTGTTGAGG - Intergenic
908356274 1:63327284-63327306 TGATCGCAAGCACTTAGTGGTGG + Intergenic
909733457 1:78925980-78926002 TAATGGTAAGCACTATGTTGAGG - Intronic
910813140 1:91258157-91258179 GGTTGGCAAGTATTTTGTTGAGG - Intergenic
914214688 1:145614681-145614703 GTATGGTAAGCACTTTGATGAGG + Intronic
914466628 1:147935071-147935093 GTATGGTAAGCACTTTGATGAGG + Intronic
1067493837 10:46743401-46743423 GGTTTGCAAGTACTTTGTTGAGG + Intergenic
1067600821 10:47597004-47597026 GGTTTGCAAGTACTTTGTTGAGG - Intergenic
1067699934 10:48563546-48563568 CGATGGCAAGCATTTAATTAAGG - Intronic
1068238256 10:54267027-54267049 GGTTTGCAAGTACTTTGTTGAGG - Intronic
1071652360 10:87404871-87404893 GGTTTGCAAGTACTTTGTTGAGG - Intergenic
1071794747 10:88991933-88991955 CTATGCCTGGCACTTTGTTGGGG - Intronic
1072421425 10:95292791-95292813 CTATGCCAAGCACTGTGCTGGGG - Intergenic
1073536386 10:104280467-104280489 CGTTGGCCAGAACTTAGTTGTGG + Intronic
1074647323 10:115473241-115473263 GGTTGGCTAGCATTTTGTTGAGG + Intronic
1080694880 11:34594847-34594869 AGATGTCAAGCACTGTGTGGTGG + Intergenic
1085043273 11:73339234-73339256 AGATGCCAAGCACTGTGCTGGGG - Intronic
1090969337 11:131626778-131626800 GGATGGCAATCGTTTTGTTGGGG - Intronic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1092812596 12:12285734-12285756 CCATGGCTAGCAGTTTGTTGTGG + Intergenic
1100712683 12:97275060-97275082 CAATGGTAAGCCCTTTGTAGTGG - Intergenic
1102328827 12:112012642-112012664 TGAAGGCACGCACTTTGTTGGGG - Intronic
1114989404 14:28268710-28268732 GGCTTGCAAGCATTTTGTTGAGG - Intergenic
1118414591 14:65521813-65521835 ACATGGCAGGCAATTTGTTGTGG + Intronic
1122345408 14:101055561-101055583 CCATGGCAAGCATTTTCCTGAGG + Intergenic
1126674092 15:51144338-51144360 AGTCAGCAAGCACTTTGTTGGGG + Intergenic
1132631214 16:918596-918618 CGATGGCCAGCACTTTTCTGGGG - Intronic
1139027353 16:62834551-62834573 CGATGGCTAACATTTTGTTGAGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1143870535 17:9954756-9954778 GGTTGGATAGCACTTTGTTGTGG - Intronic
1152071864 17:78138068-78138090 CGATGTCCAGCACATTCTTGGGG - Exonic
1153269055 18:3300947-3300969 AGTTTGCTAGCACTTTGTTGAGG - Intergenic
1157149490 18:45202207-45202229 CTATAGCAACCACTCTGTTGGGG - Intergenic
1158795063 18:60835934-60835956 TGATGGCATGAACTTTTTTGAGG - Intergenic
935519855 2:104091494-104091516 AGTTGGCTAGCATTTTGTTGAGG + Intergenic
937042441 2:118833098-118833120 CCATAGTAAGCACTTTGGTGAGG - Intergenic
937607870 2:123823910-123823932 GGTTTGCAAGTACTTTGTTGAGG - Intergenic
939682806 2:145159851-145159873 CGAGGGCAAGCAGTTTATTTGGG + Intergenic
942335306 2:174878070-174878092 CGATGGCAAGCACTTTGTTGGGG - Exonic
942346682 2:175010234-175010256 CTATAGCAAGCACTGTGTAGGGG - Intergenic
948082754 2:235220096-235220118 CAATGGGAAGCACTTCGTGGGGG - Intergenic
1173443484 20:43097376-43097398 TGATGGCCACCATTTTGTTGGGG - Intronic
1180112278 21:45665867-45665889 CGATTGCTAGTATTTTGTTGGGG - Intronic
950596022 3:13982529-13982551 TGATGTCAAGCACCTTTTTGTGG + Intronic
952047152 3:29336519-29336541 TGATGGCAATGACTTTATTGCGG + Intronic
956473463 3:69594108-69594130 CTATGGCAAGCCCTTTGGAGGGG - Intergenic
962182156 3:133218774-133218796 TGTTTGCAAGCATTTTGTTGAGG + Intronic
962944765 3:140157141-140157163 AGATTGCTAGCATTTTGTTGAGG + Intronic
970745636 4:19291690-19291712 AGTTTGCATGCACTTTGTTGAGG + Intergenic
971106334 4:23528140-23528162 GGTTTGCAAGCATTTTGTTGAGG - Intergenic
975571655 4:75824032-75824054 CAGTGGCAAGCACTTTCTTCTGG + Intergenic
975935801 4:79578689-79578711 CCATTGCCAGAACTTTGTTGTGG - Intergenic
976013143 4:80516762-80516784 AGATGGCAACTACTTTCTTGAGG - Intronic
976827306 4:89275077-89275099 CTTTGGCAAGCACTGTGTTCTGG + Intronic
977652043 4:99481687-99481709 CGTTTGCCAGTACTTTGTTGAGG + Intergenic
977792769 4:101127656-101127678 CGGTTGGTAGCACTTTGTTGAGG + Intronic
978701521 4:111652394-111652416 CTATTTCAAGCACTTTGCTGAGG - Intergenic
979519387 4:121649327-121649349 AGATGGCAAGGTCTTTGATGTGG - Intergenic
980493265 4:133558351-133558373 CGATGGTAAGTACTTTGAGGGGG - Intergenic
988609516 5:32711750-32711772 CGAGGGCAAGCTCTTTCTTGCGG + Exonic
990355889 5:54965813-54965835 CCATGGCAACCACTGTGTTATGG - Intergenic
990400479 5:55432622-55432644 GGCTGGCTAGCATTTTGTTGAGG - Intronic
991633979 5:68684592-68684614 CGATGCCTTGCATTTTGTTGGGG + Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
993350964 5:86849802-86849824 GGTTTGCAAGTACTTTGTTGAGG + Intergenic
995062204 5:107823156-107823178 CAATTGCAAGTACTTTGGTGTGG - Intergenic
1010548362 6:77187525-77187547 CGTTTGCTAGTACTTTGTTGAGG - Intergenic
1011672874 6:89700796-89700818 TGATGGCAAGGACTTTGTTAAGG + Exonic
1013647041 6:112155190-112155212 ATGTGGCAAGCACTTTGGTGGGG - Intronic
1016665738 6:146637983-146638005 GGTTGGCAAGTATTTTGTTGAGG - Intronic
1022601598 7:31765768-31765790 CAATATCAAGCACATTGTTGGGG - Intronic
1026599094 7:71759321-71759343 AGATGGCTAGTATTTTGTTGAGG + Intergenic
1047369766 8:124246671-124246693 CCATGGAAAGCACTTTGCTTGGG - Intergenic
1051788526 9:20773238-20773260 CTATGGCAAACACTTTGCTATGG + Intronic
1059077966 9:111215059-111215081 AGTTGGCCAGCATTTTGTTGAGG + Intergenic
1059679950 9:116576439-116576461 TGATGGGAAGCTCTTTGTTTTGG - Intronic
1060880192 9:127112595-127112617 CAATGGCAAGAACTCTGTCGGGG - Intronic
1187301187 X:18051583-18051605 CAATGGCAGGTACATTGTTGTGG + Intergenic
1192857617 X:75030108-75030130 GGTTTGCAAGCATTTTGTTGAGG + Intergenic
1193805441 X:85988103-85988125 CGTTTGCAAGTATTTTGTTGAGG - Intronic
1195036535 X:100975230-100975252 GGATGGCAAGTCATTTGTTGTGG - Intronic
1197643198 X:128989246-128989268 GGTTGGCTAGTACTTTGTTGAGG + Intergenic
1200066565 X:153506864-153506886 CGATGGCCTGGATTTTGTTGTGG - Exonic