ID: 942336180

View in Genome Browser
Species Human (GRCh38)
Location 2:174888823-174888845
Sequence GCACTCACTCAAAGCACTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942336178_942336180 -9 Left 942336178 2:174888809-174888831 CCTCTTGCCTCAGGGCACTCACT No data
Right 942336180 2:174888823-174888845 GCACTCACTCAAAGCACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942336180 Original CRISPR GCACTCACTCAAAGCACTAA TGG Intronic
No off target data available for this crispr