ID: 942346249

View in Genome Browser
Species Human (GRCh38)
Location 2:175005424-175005446
Sequence CCATGGGAACGCACTCGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942346249_942346262 23 Left 942346249 2:175005424-175005446 CCCGGTCGAGTGCGTTCCCATGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG 0: 1
1: 0
2: 2
3: 2
4: 32
942346249_942346257 -6 Left 942346249 2:175005424-175005446 CCCGGTCGAGTGCGTTCCCATGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 942346257 2:175005441-175005463 CCATGGCAACGGGCGCGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 41
942346249_942346260 3 Left 942346249 2:175005424-175005446 CCCGGTCGAGTGCGTTCCCATGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 942346260 2:175005450-175005472 CGGGCGCGCGCGGGGGTAAGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
942346249_942346258 -5 Left 942346249 2:175005424-175005446 CCCGGTCGAGTGCGTTCCCATGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 942346258 2:175005442-175005464 CATGGCAACGGGCGCGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 38
942346249_942346255 -7 Left 942346249 2:175005424-175005446 CCCGGTCGAGTGCGTTCCCATGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 942346255 2:175005440-175005462 CCCATGGCAACGGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 49
942346249_942346259 -4 Left 942346249 2:175005424-175005446 CCCGGTCGAGTGCGTTCCCATGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 942346259 2:175005443-175005465 ATGGCAACGGGCGCGCGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 127
942346249_942346261 4 Left 942346249 2:175005424-175005446 CCCGGTCGAGTGCGTTCCCATGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 942346261 2:175005451-175005473 GGGCGCGCGCGGGGGTAAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942346249 Original CRISPR CCATGGGAACGCACTCGACC GGG (reversed) Intergenic
909051705 1:70774945-70774967 CCCTGTGAACCCACTCCACCAGG - Intergenic
920174408 1:204091194-204091216 CCCTGGGAACCCACTAGCCCTGG - Intronic
924383231 1:243482395-243482417 CCATGGGAACAAACACGCCCGGG - Intronic
924609807 1:245564270-245564292 CCCTGGGAACAGATTCGACCTGG + Intronic
1077251967 11:1564705-1564727 CAATGGGATCGCACTCTGCCGGG + Intronic
1082184597 11:49163821-49163843 CCTTGTGAACCCACTCCACCAGG - Intronic
1083008009 11:59367276-59367298 CCTTGTGAACCCACTCCACCAGG + Intergenic
1093097593 12:14989601-14989623 CCTTGTGAACCCACTCCACCAGG + Intergenic
1113226727 13:108168022-108168044 CCCTGTGAACCCACTCCACCAGG + Intergenic
1116932401 14:50703118-50703140 CCTTGTGAACCCACTCCACCAGG - Intergenic
1118827680 14:69398749-69398771 CCATGGTACTGCACTCGACCGGG - Exonic
1118957499 14:70496719-70496741 CCTTGTGAACGCACTCCACCAGG + Intergenic
1122534476 14:102452586-102452608 CCACGGGCATGCACTGGACCAGG + Exonic
1130620264 15:85454307-85454329 CCTTGTGAACCCACTCCACCAGG - Intronic
1137364417 16:47848453-47848475 CTATGGGAACACGCTGGACCAGG - Intergenic
1143278487 17:5732242-5732264 CCCTGGGAACCTACTCCACCGGG - Intergenic
1147460907 17:40568456-40568478 CCCTGTGAACCCACTCCACCAGG + Intergenic
1152528421 17:80902795-80902817 CCATGGGACTGCACTCTAGCTGG - Intronic
1153621722 18:6985295-6985317 CCAAAGGAACGCAGTCGACCTGG - Exonic
1153785169 18:8528214-8528236 CCTTGTGAACCCACTCCACCAGG + Intergenic
1155577213 18:27260375-27260397 CCTTGAGAACCCACTCCACCAGG - Intergenic
1168643704 19:58046470-58046492 CCATGGGCACGCCCTTGGCCGGG - Intronic
929480682 2:42304530-42304552 CCATAGGAACGCACTCAGGCAGG + Exonic
931543230 2:63353167-63353189 CTATGTGAACCCACTCCACCGGG + Intronic
934976255 2:98804940-98804962 CAATGAGAACGGACTGGACCTGG + Intronic
937520865 2:122711393-122711415 CCTTGTGAACCCACTCCACCAGG + Intergenic
937606500 2:123807513-123807535 CCTTGTGAACCCACTCCACCAGG + Intergenic
940614931 2:156038292-156038314 CCTTGTGAACCCACTCCACCAGG + Intergenic
942346249 2:175005424-175005446 CCATGGGAACGCACTCGACCGGG - Intergenic
958702756 3:97615255-97615277 CCTTGCGAACCCACTCCACCAGG + Intronic
967823915 3:193863460-193863482 CTATGTGAACGCACACGACGTGG + Intergenic
969455082 4:7295896-7295918 CCATGGGAAAGCAGCCGTCCTGG - Intronic
978208066 4:106104005-106104027 CCTTGTGAACCCACTCCACCAGG + Intronic
978305503 4:107323629-107323651 CCTTGTGAACCCACTCCACCAGG - Intergenic
982218059 4:153099552-153099574 CCTTGTGAACCCACTCCACCAGG + Intergenic
986407660 5:7442476-7442498 CCAGGGGAACACACACCACCAGG - Intronic
991135449 5:63176796-63176818 CCTTGGGAACTCACTCCACCTGG - Intergenic
993018359 5:82562787-82562809 CCTTGTGAACCCACTCAACCAGG + Intergenic
994897120 5:105721010-105721032 CCTTGTGAACCCACTCCACCAGG + Intergenic
1003092812 6:3118568-3118590 CCATGGGAAAGCACCCGGCAGGG + Intronic
1007661293 6:43488321-43488343 CCAGAGGAACTCACTCGACTGGG - Intronic
1014339813 6:120190446-120190468 CCTTGTGAACCCACTCCACCAGG + Intergenic
1021176031 7:17450276-17450298 CCTTGTGAACGCAGTCTACCAGG - Intergenic
1021840991 7:24721783-24721805 GCCTGGGAACGCACTGGACATGG - Intronic
1032947893 7:136872370-136872392 CCATGGGAACTCACTCCAAAGGG - Intronic
1039845293 8:41321551-41321573 CCATGGGAAGGCACCCCATCTGG - Intergenic
1043727591 8:83629919-83629941 CCTTGTGAACCCACTCCACCAGG - Intergenic
1045594478 8:103636428-103636450 CCTTGTGAACCCACTCAACCAGG - Intronic
1048945604 8:139444295-139444317 CCATGTGAATGCACTTAACCTGG - Intergenic
1049406423 8:142453638-142453660 CCATGTGAACACCCTCGAACTGG + Intronic
1052094803 9:24370518-24370540 CCAGGTGAACCCACTCCACCAGG - Intergenic
1052311866 9:27076228-27076250 CCTTGTGAACCCACTCCACCAGG - Intergenic
1058535173 9:105950987-105951009 CCTTGTGAACCCACTCCACCAGG - Intergenic
1190132958 X:47768245-47768267 CCTTGTGAACCCACTCCACCAGG + Intergenic
1193712588 X:84896231-84896253 CCCTGTGAACCCACTCCACCAGG - Intergenic
1194947860 X:100090800-100090822 CCTTGTGAACCCACTCCACCAGG + Intergenic
1195473758 X:105261115-105261137 CCATATGAACCCACTCCACCAGG - Intronic
1200035649 X:153327761-153327783 CCTTGTGAACCCACTCCACCAGG - Intergenic