ID: 942346251

View in Genome Browser
Species Human (GRCh38)
Location 2:175005425-175005447
Sequence GCCATGGGAACGCACTCGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 24}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942346251_942346260 2 Left 942346251 2:175005425-175005447 CCGGTCGAGTGCGTTCCCATGGC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 942346260 2:175005450-175005472 CGGGCGCGCGCGGGGGTAAGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
942346251_942346264 30 Left 942346251 2:175005425-175005447 CCGGTCGAGTGCGTTCCCATGGC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 942346264 2:175005478-175005500 CCCTCATTCCCGCGGCTGCGAGG 0: 1
1: 0
2: 0
3: 9
4: 104
942346251_942346261 3 Left 942346251 2:175005425-175005447 CCGGTCGAGTGCGTTCCCATGGC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 942346261 2:175005451-175005473 GGGCGCGCGCGGGGGTAAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 116
942346251_942346255 -8 Left 942346251 2:175005425-175005447 CCGGTCGAGTGCGTTCCCATGGC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 942346255 2:175005440-175005462 CCCATGGCAACGGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 49
942346251_942346259 -5 Left 942346251 2:175005425-175005447 CCGGTCGAGTGCGTTCCCATGGC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 942346259 2:175005443-175005465 ATGGCAACGGGCGCGCGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 127
942346251_942346257 -7 Left 942346251 2:175005425-175005447 CCGGTCGAGTGCGTTCCCATGGC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 942346257 2:175005441-175005463 CCATGGCAACGGGCGCGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 41
942346251_942346262 22 Left 942346251 2:175005425-175005447 CCGGTCGAGTGCGTTCCCATGGC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG 0: 1
1: 0
2: 2
3: 2
4: 32
942346251_942346258 -6 Left 942346251 2:175005425-175005447 CCGGTCGAGTGCGTTCCCATGGC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 942346258 2:175005442-175005464 CATGGCAACGGGCGCGCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942346251 Original CRISPR GCCATGGGAACGCACTCGAC CGG (reversed) Intergenic
910029334 1:82698189-82698211 GCCATGACTGCGCACTCGACAGG + Intergenic
915229686 1:154436089-154436111 GCCATGGGCACGCCTTGGACAGG + Exonic
1079600460 11:22305594-22305616 GCCATGGGAATGTACTTGGCTGG - Intergenic
1118827682 14:69398750-69398772 CCCATGGTACTGCACTCGACCGG - Exonic
1122354539 14:101114979-101115001 GCCATGGGAACACAATCCAGTGG - Intergenic
1123007926 14:105333348-105333370 GCCATGGGAACGCCTGCAACGGG - Intronic
1124876765 15:33602069-33602091 GTCATGTGAACTCACTGGACTGG + Intronic
1125097285 15:35869567-35869589 CCCATGGGAACACATTAGACAGG + Intergenic
1141850609 16:86642754-86642776 GCTATGGGAACCCAGTGGACTGG + Intergenic
1166739251 19:45104198-45104220 GCCATGGGAACCCAGACGAGCGG - Intronic
942346251 2:175005425-175005447 GCCATGGGAACGCACTCGACCGG - Intergenic
947913755 2:233819040-233819062 GCCATGGGAATGATCTGGACAGG + Intronic
948802997 2:240441291-240441313 GCCATGGGCTGGCACTAGACAGG + Intronic
1170201114 20:13745132-13745154 GCTATGGGAACTCACACTACTGG + Intronic
969118626 4:4890254-4890276 GCCATGGGAGTGCACAAGACAGG - Intergenic
983695818 4:170528976-170528998 GCCATGGGAACGTAATGGAGAGG - Intergenic
987503156 5:18739084-18739106 GCCTGGGGAAAGCACTCAACTGG - Intergenic
1001603229 5:172942738-172942760 GCTCTGGGAACGCACGCGCCAGG - Intronic
1003092810 6:3118567-3118589 CCCATGGGAAAGCACCCGGCAGG + Intronic
1007661295 6:43488322-43488344 CCCAGAGGAACTCACTCGACTGG - Intronic
1018761612 6:166898761-166898783 GCCACGGGAACACACACAACGGG + Intronic
1029706813 7:102280543-102280565 CCCATGGGAAAGTACTCCACGGG - Intronic
1032947895 7:136872371-136872393 ACCATGGGAACTCACTCCAAAGG - Intronic
1046611318 8:116428576-116428598 GCCTTGGGAAAGCACTGTACAGG + Intergenic
1062177252 9:135170592-135170614 GCCATGGGATCCCACTGTACAGG - Intergenic