ID: 942346254

View in Genome Browser
Species Human (GRCh38)
Location 2:175005440-175005462
Sequence CCGCGCGCGCCCGTTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 27}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942346254_942346262 7 Left 942346254 2:175005440-175005462 CCCATGGCAACGGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG 0: 1
1: 0
2: 2
3: 2
4: 32
942346254_942346264 15 Left 942346254 2:175005440-175005462 CCCATGGCAACGGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 942346264 2:175005478-175005500 CCCTCATTCCCGCGGCTGCGAGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942346254 Original CRISPR CCGCGCGCGCCCGTTGCCAT GGG (reversed) Intergenic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
918765599 1:188479156-188479178 GCGCGCGCGCGTGTTGACATTGG + Intergenic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
1069738433 10:70672589-70672611 CCTCGCGCGCCCGGAGCCAGCGG + Intergenic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1096780793 12:53991002-53991024 CCTCCCGGGCCCATTGCCATGGG + Intronic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1145969664 17:28949697-28949719 GCCCGCGCGCCCGCTGCCCTCGG - Intronic
1146053008 17:29567465-29567487 CCGCGCGCGCGCTCTGCCCTCGG + Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1152321575 17:79610936-79610958 CCTCGCGCGCCCCTTGCCGCTGG - Intergenic
1163473611 19:17512172-17512194 CCGCGCCCACCGGTTGCCCTCGG + Intronic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG + Intronic
927552136 2:24010061-24010083 CCGCCCGCGGCCGTTGCCCTCGG - Exonic
937325724 2:120988748-120988770 CCCCGCGTGGCCGTGGCCATAGG - Exonic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG + Exonic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1018849939 6:167579686-167579708 CTGCGCTGACCCGTTGCCATTGG + Intergenic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1062718669 9:138023592-138023614 CCGCGCGCGCCGCTCGCCCTTGG - Exonic
1189284246 X:39840384-39840406 CCGCCCGCGCCTATTGACATCGG - Intergenic
1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG + Intergenic