ID: 942346256

View in Genome Browser
Species Human (GRCh38)
Location 2:175005441-175005463
Sequence CCCGCGCGCGCCCGTTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942346256_942346264 14 Left 942346256 2:175005441-175005463 CCATGGCAACGGGCGCGCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 942346264 2:175005478-175005500 CCCTCATTCCCGCGGCTGCGAGG 0: 1
1: 0
2: 0
3: 9
4: 104
942346256_942346262 6 Left 942346256 2:175005441-175005463 CCATGGCAACGGGCGCGCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG 0: 1
1: 0
2: 2
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942346256 Original CRISPR CCCGCGCGCGCCCGTTGCCA TGG (reversed) Intergenic
900412674 1:2520027-2520049 CCCGCGCGTGCCTCCTGCCATGG - Intronic
902350027 1:15847646-15847668 CGCGCGCGCGCCCGCGGCGAGGG + Intergenic
903628213 1:24745943-24745965 CCCGCGCGCGCCCGGCGCTGGGG - Intronic
904847555 1:33431230-33431252 CGCCCACCCGCCCGTTGCCATGG - Intergenic
905803656 1:40861470-40861492 CCCGCGCGCGCCCTCCGCGAGGG - Exonic
922831641 1:228557382-228557404 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922832118 1:228609364-228609386 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922832678 1:228611605-228611627 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922833239 1:228613846-228613868 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922833799 1:228616087-228616109 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922834356 1:228618328-228618350 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922834918 1:228620559-228620581 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922835468 1:228622762-228622784 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922836026 1:228625004-228625026 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922836583 1:228627244-228627266 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922837143 1:228629485-228629507 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922837703 1:228631727-228631749 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922838261 1:228633967-228633989 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922838820 1:228636192-228636214 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922839379 1:228638433-228638455 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922839940 1:228640664-228640686 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922840500 1:228642905-228642927 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
922841063 1:228645136-228645158 TCCGGGCCCGCCCGGTGCCACGG - Intergenic
1065189284 10:23195407-23195429 CCCGCGCGCCGCGGGTGCCATGG + Intergenic
1076659862 10:132048329-132048351 CCCGAGAGCACCCGGTGCCAAGG - Intergenic
1084192215 11:67504431-67504453 CCCCCGCCCGCCCGTCGCCATGG + Intronic
1084656523 11:70522907-70522929 CCCGCGGCCGCACGTTGCCGGGG - Intronic
1092204696 12:6607587-6607609 CGCGCGCGCGCCCGCTGCGAAGG - Intergenic
1092487333 12:8914375-8914397 CCTGCCGGCGCCCGTTGCCATGG - Intronic
1096435903 12:51591090-51591112 TCCGCGCGCGCCCCCTGCCCGGG - Intronic
1096780791 12:53991001-53991023 CCCTCCCGGGCCCATTGCCATGG + Intronic
1103488191 12:121296736-121296758 CCCCCGCGCGCCCGCCGCCCGGG - Intronic
1111672555 13:91348325-91348347 CCCGCGCGCGCCCCGGGCCCCGG - Intergenic
1112508577 13:99989835-99989857 CCCGCGGGTCCCCGATGCCACGG - Intergenic
1113493678 13:110712560-110712582 GCCACGCGAGCCCGTTGCCTAGG - Intronic
1116862105 14:50003232-50003254 GCCGCACTTGCCCGTTGCCATGG - Intronic
1117842037 14:59870405-59870427 CCGGCAGTCGCCCGTTGCCATGG - Exonic
1123036914 14:105475285-105475307 CCCGCGCGCTCCCGTGGGCCTGG + Intronic
1131144367 15:90001745-90001767 CCTGCGCGCGGCCGTCCCCAGGG - Intronic
1136399879 16:30011449-30011471 CCCGCCCGCGCGCGCGGCCACGG + Intronic
1137252087 16:46747963-46747985 CCCGCCCGGGCCCGGTGCCCGGG + Exonic
1142656889 17:1400274-1400296 GCCCCCCGCGCCAGTTGCCAGGG - Exonic
1147805066 17:43125407-43125429 CCCGCGCTTTTCCGTTGCCACGG + Exonic
1147994535 17:44353682-44353704 CCCGCGCGGGCCCGCACCCAGGG - Exonic
1148759696 17:49993361-49993383 CCCGCGCGCCCCCGCGGCCCTGG + Intronic
1150549089 17:66192281-66192303 TGCGCGCGGCCCCGTTGCCATGG + Intergenic
1151338560 17:73455485-73455507 CCTGGGCGCGTCCGTTGGCAGGG - Intronic
1152648484 17:81481331-81481353 GCCCCGCGCGCCCGAAGCCACGG + Intergenic
1163154365 19:15432171-15432193 CCCGGGAGCGTCCCTTGCCACGG - Intronic
1163692570 19:18745512-18745534 CCAGCGCCCGCCGGGTGCCAGGG - Intronic
1164147022 19:22518394-22518416 CCCGCACACGCCCGTTGCTGTGG - Intronic
1164159622 19:22617934-22617956 CAGGCGCACGCCCGTGGCCATGG + Intergenic
1165448508 19:35869471-35869493 CCCCAGCGCTCCCGTTGCTATGG - Intronic
1166938082 19:46347056-46347078 GCCGCTGGCGGCCGTTGCCAGGG + Exonic
1167333774 19:48872474-48872496 CCCGCGCCCGCTTGTCGCCACGG + Exonic
924962469 2:46616-46638 CCCGCCCCCGCCCGGTGCCCCGG + Intronic
927633420 2:24793626-24793648 CCGGCGCGCTCCCGAGGCCACGG - Intronic
935059353 2:99593992-99594014 CCCGCCCGCGGCCGTGGCCGTGG - Exonic
942346256 2:175005441-175005463 CCCGCGCGCGCCCGTTGCCATGG - Intergenic
944114243 2:196170957-196170979 CCCGCGCGGGCCCGCCGCGAAGG + Intronic
1171782345 20:29430683-29430705 CCCGCGCGCCCCCGTGGCTGTGG + Intergenic
1174436386 20:50510160-50510182 GCGGCGCGCGCCTGTTGCCTAGG - Intergenic
1176548983 21:8213467-8213489 CCCGGCCGCGCCCGTGGCCGCGG + Intergenic
1176556876 21:8257679-8257701 CCCGGCCGCGCCCGTGGCCGCGG + Intergenic
1176567912 21:8396497-8396519 CCCGGCCGCGCCCGTGGCCGCGG + Intergenic
1176575816 21:8440716-8440738 CCCGGCCGCGCCCGTGGCCGCGG + Intergenic
1179968047 21:44818154-44818176 CCTGCGCGCGCCCGACGCCCCGG - Intronic
1180167465 21:46037450-46037472 CCCGCGCGCGCCGATTCCCCTGG + Intergenic
1182435436 22:30326833-30326855 GCCGCGCGCGCCCGCGGCCGGGG - Exonic
1182576502 22:31276659-31276681 CCCACGCGCGCACGTGGCCCCGG + Intronic
1182724629 22:32433718-32433740 CCCGGGAGAGCACGTTGCCAAGG + Exonic
1183444510 22:37844235-37844257 CCCGCGCGGAGCCGTTGCCATGG - Exonic
1183586624 22:38756371-38756393 CCCGCGCGCTGCCGCTCCCAGGG - Intronic
1203253867 22_KI270733v1_random:129774-129796 CCCGGCCGCGCCCGTGGCCGCGG + Intergenic
1203261923 22_KI270733v1_random:174853-174875 CCCGGCCGCGCCCGTGGCCGCGG + Intergenic
950549069 3:13655443-13655465 CCCGCCCGCGCCCAAGGCCAGGG + Intergenic
957083147 3:75655699-75655721 CCCGCGCGCCCCCGTGGCTGTGG - Intergenic
968457162 4:705735-705757 CCCGCCCACGCCCCTTGCCGCGG + Intronic
968494857 4:909996-910018 CCCTCCAGCGCCTGTTGCCAGGG - Intronic
968506448 4:973363-973385 GCCGCGCGCGCCCGGGGCCGGGG - Exonic
970967874 4:21948844-21948866 CCCGCGCGCCCCCGCCGCCAAGG - Intergenic
985716742 5:1467217-1467239 GCCGCGCTCGCCCGTGGCCCAGG - Intronic
990910134 5:60844176-60844198 CCCGCGCGCGCCCGGCGCTTCGG - Exonic
992320794 5:75611644-75611666 GCCGGGCGCGCCCGGGGCCAAGG + Exonic
997291260 5:132737338-132737360 CGGGGGCGCGGCCGTTGCCATGG - Intronic
998143220 5:139711262-139711284 CCCGCCTGCGCCCGGTGCCCCGG - Intergenic
1000220497 5:159209453-159209475 CCCGCGAGCGCCTGCTGCCGCGG - Intronic
1008545055 6:52576912-52576934 CCGCTGCGCGCCCGCTGCCATGG - Exonic
1026471341 7:70695439-70695461 CCGGCCCGCACCCGGTGCCAAGG + Intronic
1026805866 7:73429427-73429449 CCCAGGCGCGGCCGTTGCCATGG + Intergenic
1034412216 7:150947579-150947601 CCCTCGCCCGCCCGTCGCCCGGG + Intronic
1034446195 7:151115407-151115429 CGCGCGCGCACCCGTAGCGACGG + Intronic
1034680688 7:152925478-152925500 CCCGCGCGCGCCCGGCCCCTCGG - Intergenic
1037348252 8:17922902-17922924 CCCCCGCGCGGCCGTTGCCGAGG + Exonic
1049040404 8:140108509-140108531 CCCGCTCGCCCCCCTTGCCCAGG + Intronic
1049665610 8:143841291-143841313 CCCGCCCCCGCCCGTTCCCAGGG + Intergenic
1061072920 9:128322840-128322862 TCCGCGGACGCCCGCTGCCATGG + Exonic
1061472149 9:130835289-130835311 CCCGCGCCCGCCCATGGCCGCGG - Intronic
1061580112 9:131531203-131531225 CCCGCGCCCGCCCCTTCCCCAGG + Intronic
1203470267 Un_GL000220v1:112918-112940 CCCGGCCGCGCCCGTGGCCGCGG + Intergenic
1203478088 Un_GL000220v1:156890-156912 CCCGGCCGCGCCCGTGGCCGCGG + Intergenic
1196684089 X:118495953-118495975 CCCGCCCGCCGCCGCTGCCATGG + Exonic