ID: 942346262

View in Genome Browser
Species Human (GRCh38)
Location 2:175005470-175005492
Sequence AGGGTGCGCCCTCATTCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 32}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942346251_942346262 22 Left 942346251 2:175005425-175005447 CCGGTCGAGTGCGTTCCCATGGC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG 0: 1
1: 0
2: 2
3: 2
4: 32
942346254_942346262 7 Left 942346254 2:175005440-175005462 CCCATGGCAACGGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG 0: 1
1: 0
2: 2
3: 2
4: 32
942346256_942346262 6 Left 942346256 2:175005441-175005463 CCATGGCAACGGGCGCGCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG 0: 1
1: 0
2: 2
3: 2
4: 32
942346249_942346262 23 Left 942346249 2:175005424-175005446 CCCGGTCGAGTGCGTTCCCATGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG 0: 1
1: 0
2: 2
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942346262 Original CRISPR AGGGTGCGCCCTCATTCCCG CGG Intergenic
903168694 1:21538718-21538740 AGGGTGCGCCCACCTGGCCGGGG + Intronic
904858478 1:33517653-33517675 AGGGTTCCCCCTTATTCCAGTGG - Intronic
905230528 1:36512385-36512407 AGGGTGCGGCCTCATTCCTGTGG + Intergenic
914420371 1:147523189-147523211 AGGGTGCCCACTCAGTCCAGAGG + Intergenic
1064553781 10:16528108-16528130 TGAATGCACCCTCATTCCCGGGG - Intergenic
1069544356 10:69318381-69318403 GGGGCGAGCCCTCATTTCCGAGG + Intronic
1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG + Intronic
1075778631 10:125003325-125003347 AGGGTGGGCCCACCTTCTCGTGG + Exonic
1083274270 11:61587962-61587984 AGGGTGGGGCCTCAATCCTGGGG - Intergenic
1083323893 11:61863640-61863662 AGGGCCCGGCCTCATTCCCAGGG - Intronic
1103952213 12:124557497-124557519 AGGGTGGGCCCTAAATCCAGTGG - Intronic
1104894801 12:132158884-132158906 AGGGTGGGCCATCAGTCCGGTGG + Intergenic
1139340053 16:66262601-66262623 AGGCTGTGCCCTCATCCCCTAGG - Intergenic
1160726482 19:619933-619955 AGGGTGTGCCCTGCTGCCCGGGG - Intronic
1162397151 19:10423894-10423916 AGGGTCCTCCCCCATTCCCAGGG + Intronic
1162638320 19:11987620-11987642 ATGCTGCGCCCTCCTTCCGGCGG - Intergenic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
926313307 2:11691170-11691192 AGGGTCCACCCTCAGTCCTGTGG + Intronic
927198345 2:20563416-20563438 AGGCTGGGCCCTCATTGCTGGGG - Intronic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
948570079 2:238912457-238912479 AGGGTGCCCCCTCATTTGCACGG - Intergenic
1172625592 20:36344847-36344869 AGGGTCCCCCCTCCTTCCCTAGG + Intronic
1175415324 20:58797098-58797120 AGGGCCCACCCTCATTCCCGAGG + Intergenic
960955515 3:123027926-123027948 AGGGGGCGCCCTGCATCCCGCGG + Intronic
968273452 3:197422528-197422550 AGGGTTCGCCCTCCTCCCCCTGG - Intergenic
985484759 5:141848-141870 AGGCTGAGCCCTCCTTTCCGTGG + Intronic
997631718 5:135373796-135373818 AGGGTGGGCCCTCAGCCCTGTGG + Intronic
998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG + Intergenic
1016965801 6:149717881-149717903 AGCGTCCGCCCTCAGGCCCGTGG - Exonic
1021959868 7:25860498-25860520 AGGGAGCGCCCGCAGTCCTGCGG + Intergenic
1023081935 7:36534174-36534196 AGGGTGGGCCTTCATCCCCAAGG - Intronic
1037758484 8:21726685-21726707 AGGGTGGGCCCTAAATCCAGTGG - Intronic
1052237933 9:26235071-26235093 GGGGTGCCCCCTCATTCCTGAGG - Intergenic
1053306241 9:36986487-36986509 AGCGGGCGGCCTCCTTCCCGGGG + Intronic
1060712941 9:125889181-125889203 TGGGTTCGCCCACATCCCCGTGG + Intronic
1061055060 9:128218170-128218192 AGGGGGCGCCCTCTGTCCCAGGG - Intronic