ID: 942346264

View in Genome Browser
Species Human (GRCh38)
Location 2:175005478-175005500
Sequence CCCTCATTCCCGCGGCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942346251_942346264 30 Left 942346251 2:175005425-175005447 CCGGTCGAGTGCGTTCCCATGGC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 942346264 2:175005478-175005500 CCCTCATTCCCGCGGCTGCGAGG 0: 1
1: 0
2: 0
3: 9
4: 104
942346254_942346264 15 Left 942346254 2:175005440-175005462 CCCATGGCAACGGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 942346264 2:175005478-175005500 CCCTCATTCCCGCGGCTGCGAGG 0: 1
1: 0
2: 0
3: 9
4: 104
942346256_942346264 14 Left 942346256 2:175005441-175005463 CCATGGCAACGGGCGCGCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 942346264 2:175005478-175005500 CCCTCATTCCCGCGGCTGCGAGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942346264 Original CRISPR CCCTCATTCCCGCGGCTGCG AGG Intergenic
900382516 1:2391903-2391925 TCCTCCTTCCCGCGGCCGTGAGG + Exonic
901806216 1:11740244-11740266 CCCTCTTTCCCTGGGCTGCCAGG + Intronic
903212940 1:21828840-21828862 CGCTCACTTCCGCGGCTGTGTGG - Exonic
903742086 1:25564122-25564144 TCCTCATTCAGGCGGCTGAGGGG - Intronic
909548075 1:76868805-76868827 CCCCCTTTCCCGGGGCTGGGAGG + Intronic
913515608 1:119603169-119603191 CCCTCATTCCCCAAGCTGCTAGG - Intergenic
913942223 1:125119422-125119444 CCCTCAGACCCGCGGCGGTGGGG - Intergenic
916717327 1:167456288-167456310 CCCTCATTCCTGCAGCTGGGTGG - Intronic
919607030 1:199695644-199695666 CCCTCACTCCCTGGGCTGCATGG + Intergenic
919862165 1:201747195-201747217 CCCCCATTCTCGTGGCTGTGCGG + Intronic
922210066 1:223479638-223479660 CCCTTCTTCCCACGGCTGTGGGG - Intergenic
922440698 1:225653194-225653216 CCCTCCTTCCCCCGGGGGCGAGG + Intergenic
1065101607 10:22336573-22336595 CCTTCGTTCCAGGGGCTGCGGGG + Intergenic
1066954192 10:42149693-42149715 CCCTCAGACCCGCGGCGGTGGGG + Intergenic
1071085364 10:81862942-81862964 CCCTCATTGCCCCGGCTGGCAGG + Intergenic
1075421866 10:122307724-122307746 CCCTCATTCCTGAGGCTGTGGGG - Intronic
1076650430 10:131982841-131982863 CTCCCAGTCCCGAGGCTGCGAGG - Intergenic
1076803869 10:132845502-132845524 CCCTCCCTCCTTCGGCTGCGTGG - Intronic
1077327496 11:1970028-1970050 CCCTCCCACCCGCGGCTGGGAGG - Intronic
1083033579 11:59615782-59615804 CCCTCCTCCCCGCGGCTGGCCGG - Exonic
1083480275 11:62939917-62939939 CACTCATTCCCCCGGCTATGGGG + Intronic
1085741707 11:79082911-79082933 CCCTCTTTCCAGCAGCTGGGTGG + Intronic
1086399200 11:86447029-86447051 CCTTCCTTCCCCCGGCTGAGAGG - Intronic
1087016593 11:93560076-93560098 CCCTCGGTCCCTCGGCTGCAGGG - Intergenic
1090425324 11:126603388-126603410 CCCTCATTCCTGAGGCTCCCAGG - Intronic
1202810478 11_KI270721v1_random:25208-25230 CCCTCCCACCCGCGGCTGGGAGG - Intergenic
1100315403 12:93441248-93441270 CCCTGGTTGCCGCGGCTGCCTGG - Intronic
1102520581 12:113475613-113475635 CCCTCATTCCGGCCGCTGCCCGG - Intergenic
1104852522 12:131884098-131884120 CCATCCTTCCCGTGGCTGAGTGG - Intergenic
1116003317 14:39267130-39267152 CCCGCCTTCTCGCGGCTGCCCGG + Exonic
1117677015 14:58165649-58165671 CCCTGATTACCGAGGCTGGGTGG + Intronic
1123393219 15:19899167-19899189 CCCTCAGAGCCGCGGCGGCGGGG - Intergenic
1132275414 15:100559165-100559187 CCATCTTCCCCGCTGCTGCGCGG - Intergenic
1132505904 16:308579-308601 CCGTCATCCCAGCGGCTCCGCGG + Intronic
1134402191 16:13920379-13920401 CCCTCACTCCCGCGCCAGCGCGG - Intronic
1135609740 16:23855914-23855936 CACTCATTCCCCCAGCTGCTGGG - Intronic
1136696316 16:32084661-32084683 CCCTCAGACCCGCGGCGGTGGGG + Intergenic
1136699214 16:32116533-32116555 CCCTCAGAGCCGCGGCGGCGGGG - Intergenic
1136768439 16:32811401-32811423 CCCTCAGAGCCGCGGCGGCGGGG + Intergenic
1136796811 16:33027913-33027935 CCCTCAGACCCGCGGCGGTGGGG + Intergenic
1136799705 16:33059704-33059726 CCCTCAGAGCCGCGGCGGCGGGG - Intergenic
1137084275 16:36101538-36101560 CCCTCAGACCCGCGGCGGTGGGG + Intergenic
1142021385 16:87785027-87785049 CCCACATTCCGGCTGCTGTGAGG - Intergenic
1203070831 16_KI270728v1_random:1073417-1073439 CCCTCAGAGCCGCGGCGGCGGGG + Intergenic
1142747821 17:1968734-1968756 CCCTCCTTCCCGCACCTGCCTGG + Intronic
1144697289 17:17313620-17313642 GCCTCATCCCAGGGGCTGCGGGG + Intronic
1145690157 17:26731563-26731585 CCCTCAGACCCGCGGCGGTGGGG - Intergenic
1145694521 17:26775728-26775750 CCCTCAGTGCCGCGGCGGCGGGG - Intergenic
1146491956 17:33289937-33289959 CCCTCATTCCTTCAGCTTCGTGG + Intronic
1147307744 17:39575287-39575309 CCCTCTTTCCCAGGGCTGAGAGG - Intergenic
1151209044 17:72530243-72530265 CCCTCATCCCCTCTCCTGCGAGG - Intergenic
1151919204 17:77141041-77141063 CGCTCATACCGGCGGCTCCGCGG - Intronic
1152122503 17:78427331-78427353 CGCTCATGGCCGCGGCTGCAGGG - Intronic
1154518344 18:15197904-15197926 CCCTCAGAGCCGCGGCGGCGGGG + Intergenic
1160698695 19:496469-496491 CCCTCTGTCCCGAGGCCGCGGGG - Intronic
1164039706 19:21483739-21483761 CCCTCCTCCCCGCTGCTGAGTGG - Intronic
1166078226 19:40426145-40426167 CCCTCACTCGCGCAGCTGCCCGG - Intergenic
1168691647 19:58381013-58381035 CCCTCAGTGCCGCGGCGGCCCGG - Exonic
927155297 2:20217806-20217828 CCTTCATTCCTGCTGCTGAGCGG + Intronic
927187864 2:20495105-20495127 CCCTCATTCCCCAGGCTGTGAGG - Intergenic
928420904 2:31137536-31137558 ACCTCCTTCCCGCAGCTGCCAGG - Intronic
932258190 2:70304630-70304652 CCCTGATTCCAGCTGCTGCTGGG - Intergenic
932630822 2:73341781-73341803 CCCTCAGTCCTGCAGCTGCAAGG + Intergenic
934251611 2:90360182-90360204 CCCTCAGACCCGCGGCGGTGGGG + Intergenic
934257948 2:91443216-91443238 CCCTCAGACCCGCGGCGGTGGGG - Intergenic
938518264 2:132038149-132038171 CCCTCAGAACCGCGGCGGCGGGG + Intergenic
942346264 2:175005478-175005500 CCCTCATTCCCGCGGCTGCGAGG + Intergenic
942454607 2:176129565-176129587 TCCGCATTCCCGCGGCCCCGGGG + Intergenic
943494767 2:188606648-188606670 CCCTCATTGCCGGGGCAGCAGGG + Intergenic
1169227819 20:3866920-3866942 CCCTCACTTCCGGGGCTGTGTGG + Exonic
1173645377 20:44629874-44629896 CCCTGCTTCCCGTGGCTGGGAGG - Intronic
1175767096 20:61599254-61599276 CCCTCTTTCACCCGGCTGAGCGG + Intronic
1176045859 20:63092257-63092279 CCCAGGTTCCCGGGGCTGCGTGG + Intergenic
949392450 3:3578014-3578036 CCCTCATTCCTGCGCCCGAGTGG + Intergenic
954895958 3:53974918-53974940 CCCTCCTTCCCTCGGCTGCTAGG - Intergenic
956604932 3:71064768-71064790 CTCTCCTTCCCCCGGCTCCGCGG - Intronic
960955517 3:123027934-123027956 CCCTGCATCCCGCGGCTGCTCGG + Intronic
962738862 3:138348657-138348679 CCGTCAGTCCGGCGGCCGCGGGG + Intronic
972346393 4:38196066-38196088 GCCTCATTCCCGGGGCAGTGGGG + Intergenic
973236850 4:47914658-47914680 CCCGCGTTCCGGCGACTGCGTGG + Intronic
974385703 4:61200831-61200853 CCCACATGCCCGCAGCTGCCCGG + Intergenic
975619621 4:76283061-76283083 GCCTCATTCCCTCTGCTGCACGG + Intronic
977922556 4:102661407-102661429 GCCTCATTCCCGATGCTGTGGGG - Intronic
984162924 4:176275855-176275877 CCCTCATCCCCACTGCAGCGAGG + Intronic
985101937 4:186467087-186467109 CACTCATTCCCACAGCTGCTGGG + Intronic
998583706 5:143404526-143404548 CCCTCTTCCCCGAGTCTGCGAGG + Intronic
999739769 5:154541539-154541561 CCATCATTCCCGTGGCTTAGAGG + Intergenic
1001179552 5:169506695-169506717 CACTCATTCCCCCAGCTGCTAGG - Intergenic
1001410760 5:171509631-171509653 CCCGCATGCCCACTGCTGCGGGG + Intergenic
1002389235 5:178896253-178896275 CCCCCATCCCCGCTGCTCCGGGG - Intronic
1005589892 6:27312334-27312356 CCCCCGTTCCCGCGGGTGCCGGG - Intergenic
1005686667 6:28259497-28259519 CTCTCACTCCCGCGGCCGTGAGG + Exonic
1008131808 6:47727584-47727606 CACTCATTCCCCCAGCTGCCAGG + Intergenic
1017470378 6:154733189-154733211 CGCTCACTCCCGCGTCCGCGGGG + Intergenic
1019006276 6:168799261-168799283 CCCTCTATCCCCCGGCTGCAAGG + Intergenic
1022959507 7:35413101-35413123 CCCTCAGTCCTGCAGCTGCAAGG + Intergenic
1023401707 7:39796150-39796172 CCCTGATTCCCACCCCTGCGGGG - Intergenic
1025306721 7:57868140-57868162 CCCTCAGAGCCGCGGCGGCGGGG + Intergenic
1025320335 7:58087884-58087906 CCCTCAGACCCGCGGCGGTGGGG - Intergenic
1025561960 7:62380611-62380633 CCCTCAGAGCCGCGGCGGCGGGG - Intergenic
1029590315 7:101502843-101502865 CCCTCCTTCCCGGGGCTGCCTGG + Intronic
1030938809 7:115618958-115618980 CACTCATTCCCCCTGCTGCCAGG - Intergenic
1032167373 7:129556089-129556111 CACTCATTTCCCCGGCTGCCGGG + Intergenic
1032410363 7:131689834-131689856 CCCTCCTGCCCGCGGCTAAGCGG - Intergenic
1034539299 7:151745942-151745964 CCCTGATTCCAGCTGCTCCGTGG + Intronic
1036785285 8:11681439-11681461 CCCGGATTCCGGCGTCTGCGCGG - Intronic
1041231602 8:55757974-55757996 CCCTCATTCCCCCTGGTGCTGGG - Intronic
1043031433 8:75138398-75138420 CCCTCATTTCCCCAGCTGCTGGG + Intergenic
1049535843 8:143181358-143181380 CACTCTTTCCCGCAGCTGCGTGG + Intergenic
1051097240 9:13480732-13480754 CACTCATTCCCTCAGCTGCTGGG + Intergenic
1054460736 9:65461029-65461051 CCCTCACCCCCACGGCTGTGGGG + Intergenic
1062281003 9:135751564-135751586 CCCTCATCGCGGCTGCTGCGAGG - Intronic
1062414114 9:136439357-136439379 CCTCCCTTCCGGCGGCTGCGGGG + Exonic
1190862549 X:54358203-54358225 CCCTCTCTCCCGCGGCGCCGAGG - Intronic