ID: 942348466

View in Genome Browser
Species Human (GRCh38)
Location 2:175028200-175028222
Sequence ACTTTAGGGCAAAAGCCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942348466_942348475 14 Left 942348466 2:175028200-175028222 CCTGTTGGCTTTTGCCCTAAAGT No data
Right 942348475 2:175028237-175028259 AAGAGGCATGACTGTTTCCCAGG No data
942348466_942348469 -10 Left 942348466 2:175028200-175028222 CCTGTTGGCTTTTGCCCTAAAGT No data
Right 942348469 2:175028213-175028235 GCCCTAAAGTCCCGTGGGAGTGG No data
942348466_942348472 -3 Left 942348466 2:175028200-175028222 CCTGTTGGCTTTTGCCCTAAAGT No data
Right 942348472 2:175028220-175028242 AGTCCCGTGGGAGTGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942348466 Original CRISPR ACTTTAGGGCAAAAGCCAAC AGG (reversed) Intergenic
No off target data available for this crispr