ID: 942350398

View in Genome Browser
Species Human (GRCh38)
Location 2:175046542-175046564
Sequence CAGGGTAATTAGAGTAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942350395_942350398 -4 Left 942350395 2:175046523-175046545 CCTGGTCTAGTTTTGGAAACAGG No data
Right 942350398 2:175046542-175046564 CAGGGTAATTAGAGTAATGTTGG No data
942350392_942350398 20 Left 942350392 2:175046499-175046521 CCATAGTTTTTTATTTTGTTATG No data
Right 942350398 2:175046542-175046564 CAGGGTAATTAGAGTAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942350398 Original CRISPR CAGGGTAATTAGAGTAATGT TGG Intergenic
No off target data available for this crispr