ID: 942352216

View in Genome Browser
Species Human (GRCh38)
Location 2:175064945-175064967
Sequence CACCGCAGAGTGAAGTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942352209_942352216 13 Left 942352209 2:175064909-175064931 CCCAGTGGCCTGAACTTAAGTTC No data
Right 942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG No data
942352208_942352216 18 Left 942352208 2:175064904-175064926 CCGATCCCAGTGGCCTGAACTTA No data
Right 942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG No data
942352212_942352216 -9 Left 942352212 2:175064931-175064953 CCCAAAAGCCTCACCACCGCAGA No data
Right 942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG No data
942352206_942352216 30 Left 942352206 2:175064892-175064914 CCAGAGGAATCGCCGATCCCAGT No data
Right 942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG No data
942352210_942352216 12 Left 942352210 2:175064910-175064932 CCAGTGGCCTGAACTTAAGTTCC No data
Right 942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG No data
942352213_942352216 -10 Left 942352213 2:175064932-175064954 CCAAAAGCCTCACCACCGCAGAG No data
Right 942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG No data
942352211_942352216 5 Left 942352211 2:175064917-175064939 CCTGAACTTAAGTTCCCAAAAGC No data
Right 942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942352216 Original CRISPR CACCGCAGAGTGAAGTGCTC TGG Intergenic
No off target data available for this crispr