ID: 942353371

View in Genome Browser
Species Human (GRCh38)
Location 2:175078558-175078580
Sequence CTTTCAGTGCTAAAACTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942353366_942353371 9 Left 942353366 2:175078526-175078548 CCACGACTGAGGGGTCTTCTTAG No data
Right 942353371 2:175078558-175078580 CTTTCAGTGCTAAAACTGGGCGG No data
942353365_942353371 10 Left 942353365 2:175078525-175078547 CCCACGACTGAGGGGTCTTCTTA No data
Right 942353371 2:175078558-175078580 CTTTCAGTGCTAAAACTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942353371 Original CRISPR CTTTCAGTGCTAAAACTGGG CGG Intronic
No off target data available for this crispr