ID: 942361716

View in Genome Browser
Species Human (GRCh38)
Location 2:175179963-175179985
Sequence ATCTAGTTTTTTGGATAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 0, 2: 5, 3: 91, 4: 492}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942361716 Original CRISPR ATCTAGTTTTTTGGATAAAA GGG Intronic
900841649 1:5053366-5053388 ATACAGTTTTAGGGATAAAAAGG - Intergenic
905060273 1:35134238-35134260 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
906081129 1:43089095-43089117 GTCAAGTTATTTGGACAAAAAGG - Intergenic
906530654 1:46522036-46522058 ATATAGTCTAATGGATAAAATGG + Intergenic
907167652 1:52428796-52428818 ATATACTTTTTTAGATAAACAGG + Intronic
907173599 1:52496893-52496915 ATCTACTTTTAAGGAGAAAAGGG + Intronic
907380964 1:54088269-54088291 ATCTAGTTTTTTGGGGGAAGGGG - Intronic
908277603 1:62491715-62491737 ATCTTGTCTATTGGATGAAATGG - Intronic
908685455 1:66713637-66713659 ATGGAGTTTATTGTATAAAAGGG - Intronic
908871035 1:68612834-68612856 ATTCTGTTTATTGGATAAAACGG - Intergenic
909511718 1:76460909-76460931 ATTAAGTATTTTGGATAAATGGG + Intronic
910179223 1:84463177-84463199 ATTAAGTTTTTAGGATAGAAGGG - Intergenic
910266624 1:85344759-85344781 ATCCAGGTTTTTGGAAAAGAAGG + Intronic
911984077 1:104599778-104599800 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
912105900 1:106274758-106274780 ATCTAGAAATTTGGATAAAATGG - Intergenic
912939148 1:114029744-114029766 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
913095505 1:115512293-115512315 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
913128148 1:115812313-115812335 ATCTATTTTATTGTATAAAGTGG - Intergenic
913278877 1:117165969-117165991 AGCTGGTTATTTGGATAAAATGG - Intronic
916295106 1:163210416-163210438 TTCTAGTTTTATGGATATAATGG + Intronic
916329057 1:163594451-163594473 GTCAACTTGTTTGGATAAAAAGG - Intergenic
916369692 1:164077258-164077280 ATCTTGTTTCTTTGAAAAAATGG - Intergenic
917021659 1:170594826-170594848 ATTTATTTGTTTGAATAAAAGGG - Intergenic
918671774 1:187226030-187226052 ATCTAATCTTTTTTATAAAAAGG - Intergenic
919026850 1:192183150-192183172 ACATAGTTTTTTTTATAAAAAGG + Intronic
920901329 1:210113091-210113113 GTCAAGTTGTTTGGACAAAAAGG + Intronic
921802911 1:219421768-219421790 AGCTAGTTTCTCGGAAAAAAAGG + Intergenic
921856423 1:219990787-219990809 TACTAGTTTTCTGGATCAAAAGG + Intronic
921877229 1:220211713-220211735 TTATAGTTTTTTGGATAAGCTGG - Intronic
921907230 1:220508070-220508092 CTCAAGTCTTTTGTATAAAATGG - Intergenic
922046677 1:221951882-221951904 GTCAAGTTGTTTGGATAGAAAGG - Intergenic
922363325 1:224842584-224842606 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
923025795 1:230202998-230203020 AGCTAGTTTGTTGTTTAAAATGG + Intronic
923646075 1:235821633-235821655 ATCTGGTTCTTTATATAAAAAGG - Intronic
923970056 1:239190212-239190234 ATCTTGTTTTTAGGAAAAACTGG + Intergenic
923979020 1:239299070-239299092 ATCTACTTTTCTGGGCAAAATGG + Intergenic
924180907 1:241437771-241437793 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
924358294 1:243208002-243208024 AGCAAGTTTTGTGGAGAAAATGG - Intronic
924579628 1:245312653-245312675 ACCTACTTTTTTCCATAAAAAGG - Intronic
924895964 1:248338348-248338370 ATCAAGTTGTTTGGACAGAAAGG + Intergenic
1063363399 10:5474911-5474933 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1065437871 10:25720251-25720273 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1067352519 10:45489124-45489146 ATATGGTTTTCTGGAAAAAATGG + Intronic
1067360605 10:45574644-45574666 GTCAAATTGTTTGGATAAAAAGG - Intronic
1068062256 10:52082725-52082747 GTCAAGTGTTTTGGATAAATGGG - Intronic
1068596689 10:58909622-58909644 ATCTATTATTTGGGAGAAAAAGG - Intergenic
1070206790 10:74272080-74272102 GTGTAGTTATTTGCATAAAAGGG + Intronic
1070224316 10:74484558-74484580 ATCTTGTTTTTTGGTTGGAAAGG - Intronic
1071282144 10:84112580-84112602 ATCTAGTTGTTTGGAGAGATAGG - Intergenic
1071961356 10:90811207-90811229 GTCAAGTTGTTTGGACAAAAAGG - Intronic
1073233862 10:101996533-101996555 ATCTAGTTTTCTGGAGGCAAGGG - Intronic
1073526481 10:104187899-104187921 AGACAGTTTTCTGGATAAAAAGG - Intronic
1074019276 10:109566160-109566182 GTCAAATTGTTTGGATAAAAAGG - Intergenic
1076514745 10:131037636-131037658 ATGAAGCTTTGTGGATAAAAGGG - Intergenic
1077588533 11:3473403-3473425 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1077688297 11:4318034-4318056 GTCAAGTTTTTTGGACAGAAAGG + Intergenic
1077825534 11:5804925-5804947 AGCTAGTTTATTGGATAAAGTGG + Intronic
1077883599 11:6369605-6369627 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1078789265 11:14526422-14526444 GTCAAGTTGTTTGGACAAAAAGG - Intronic
1079529307 11:21430454-21430476 ATAGAGATTTTTAGATAAAATGG - Intronic
1079847439 11:25489134-25489156 GTCAAGTTGTTTGGATAGAAAGG + Intergenic
1079926388 11:26497330-26497352 ATGTACTTTTTTTGATATAATGG + Intronic
1080255435 11:30285207-30285229 ATATAGTTGTTTGGTGAAAATGG + Intergenic
1080275312 11:30497198-30497220 AGCAAGTTGTTTGGATAGAATGG + Intronic
1081104727 11:39051090-39051112 ATATATTTTCTTTGATAAAATGG - Intergenic
1081159970 11:39738365-39738387 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1081293485 11:41355728-41355750 ATCCATTTTTGGGGATAAAATGG + Intronic
1081542579 11:44046741-44046763 GTCTAGATTTTTAGAAAAAAGGG + Intergenic
1082251619 11:49987936-49987958 ATATAATTTTTTGCATATAATGG + Intergenic
1082647338 11:55744224-55744246 ATCTAAATTTATGGAGAAAATGG - Intergenic
1082652897 11:55816420-55816442 AACTAGTTCTTTGGTTAAAAAGG - Intergenic
1083376092 11:62222751-62222773 AGCTAGTTTATTGGATAAAGCGG - Intergenic
1084244237 11:67845032-67845054 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1084354468 11:68628107-68628129 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1084828450 11:71749530-71749552 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1085570458 11:77553839-77553861 GTCAAGTTGTTTGGACAAAAAGG - Intronic
1085886370 11:80527172-80527194 ATATAGTTTTTAAGATAAATGGG - Intergenic
1086133351 11:83422536-83422558 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1086136028 11:83444815-83444837 GTCAAGTTGTTTGAATAAAAAGG + Intergenic
1087099880 11:94353430-94353452 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1087122093 11:94585659-94585681 TTCAAGTTTTTTTAATAAAATGG + Intronic
1087333290 11:96811361-96811383 ATGCAGTTATTTGGATAAATAGG - Intergenic
1087386514 11:97476378-97476400 ATTTACTTTTTTGTATCAAATGG - Intergenic
1087450849 11:98322124-98322146 ATTTATGTTTTTGGTTAAAAAGG + Intergenic
1087839294 11:102905996-102906018 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
1088555198 11:111053989-111054011 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1089874811 11:121710306-121710328 TTAAAGTTTTTTGGATAAAAGGG - Intergenic
1089953578 11:122550917-122550939 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1090107355 11:123867492-123867514 GTCAAGTTGTTTGCATAAAAAGG + Intergenic
1090143690 11:124294431-124294453 ATCTAATTTTGTTGACAAAAAGG - Intergenic
1090526566 11:127544649-127544671 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1090546255 11:127770992-127771014 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1091183923 11:133630593-133630615 GTCAAATTGTTTGGATAAAAAGG - Intergenic
1092414798 12:8282173-8282195 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1092924576 12:13261710-13261732 TTCAAGTTGTTTGGACAAAAAGG + Intergenic
1093321776 12:17722319-17722341 GTCAAGTTTTTTGGATAAAAAGG + Intergenic
1093329718 12:17820668-17820690 TTTTAGTTTTTGGCATAAAATGG + Intergenic
1093358700 12:18198913-18198935 GTCAAGTTGTTTGGACAAAAAGG - Intronic
1093363748 12:18266221-18266243 CTCTAGTGTTTTGGAAAATACGG + Intronic
1094315804 12:29136897-29136919 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
1094400924 12:30059778-30059800 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1094419319 12:30254277-30254299 AGCTGGTTTTTAGGAAAAAAGGG - Intergenic
1094826005 12:34269589-34269611 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1095806521 12:46325850-46325872 GTCAAGTTGTTTGGACAAAAGGG + Intergenic
1095998769 12:48112039-48112061 GTCAAGTCATTTGGATAAAAAGG + Intronic
1096744928 12:53720119-53720141 ATCTAGTCTTTTTGAGACAAGGG + Intronic
1096767553 12:53905480-53905502 ATCTAGTGTTTAGGAGGAAAAGG - Intergenic
1097541946 12:60953896-60953918 GTCAAGTTGTTTGGACAAAAGGG + Intergenic
1097592574 12:61590452-61590474 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1097593181 12:61596476-61596498 ATCAAATTTTCTGGATAATAAGG - Intergenic
1098631420 12:72727033-72727055 ATCTAGTTTTATTGATATAGAGG + Intergenic
1098653582 12:73003925-73003947 GTCGAGTTGTTTGGATAAAAAGG + Intergenic
1098920163 12:76295420-76295442 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1099256100 12:80314612-80314634 AGTTAATTTTTTAGATAAAAAGG + Intronic
1099262974 12:80407656-80407678 ATCTATTTTCCTGTATAAAATGG - Intronic
1099762833 12:86942603-86942625 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1099835856 12:87909314-87909336 GTCTAGTTGTTTGGATAAAAAGG + Intergenic
1100763516 12:97835920-97835942 ATTTAGTTTTTTGGGTTAATTGG - Intergenic
1102604754 12:114059802-114059824 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1102749653 12:115281266-115281288 ATCTGGTGTTTTGGAGAAATGGG + Intergenic
1102996352 12:117354021-117354043 ACATATTTTTTTGGCTAAAATGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105490044 13:20879447-20879469 TTCAAGTTTTTTGGACAACATGG - Intronic
1107220053 13:37971096-37971118 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
1107616227 13:42171083-42171105 ATGTAGTTTTCTGGATACAGTGG + Intronic
1108202941 13:48060177-48060199 GTCAAATTGTTTGGATAAAAAGG - Intronic
1108947678 13:56044108-56044130 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1109343842 13:61092326-61092348 GTCAAGTTGTTTGGACAAAATGG - Intergenic
1109353160 13:61208601-61208623 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1110181087 13:72617612-72617634 ATCTTTTATTTTGGAGAAAATGG - Intergenic
1110333875 13:74303562-74303584 ATATACTTTTTTTGATGAAATGG + Intergenic
1110480136 13:75964515-75964537 ATCTAGCTGTTTGGATTTAAGGG + Intergenic
1110650247 13:77935241-77935263 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
1111179737 13:84648301-84648323 ATGTAGTTTTTTTGTTAACATGG + Intergenic
1111238283 13:85438372-85438394 ATCAATTTTTTTTGAGAAAAGGG + Intergenic
1111547854 13:89767290-89767312 CTCAAGTTCTTTGTATAAAATGG + Intergenic
1113023418 13:105914429-105914451 ATACAATTTTTTGGAGAAAAAGG + Intergenic
1116179920 14:41519748-41519770 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1116573667 14:46547504-46547526 ATCAAGTTGTTTGGACAGAAAGG - Intergenic
1116702151 14:48257293-48257315 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1116965612 14:51011580-51011602 ATCTAGTGTTTTGGATTTTATGG + Intronic
1117366222 14:55031124-55031146 ATCTAATTTATTCCATAAAATGG + Intronic
1117812237 14:59559739-59559761 AGCAAATTTTTTGAATAAAAAGG + Intronic
1117879218 14:60293318-60293340 ATCAAGCTTTATTGATAAAATGG - Intronic
1117957667 14:61135331-61135353 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1118368341 14:65114701-65114723 ATCTATTTTAGTGGATACAAGGG - Intergenic
1118553493 14:66984868-66984890 AACTAATGTTTTGGATAAAGAGG - Intronic
1118936995 14:70297542-70297564 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1120618481 14:86735121-86735143 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1120659688 14:87236782-87236804 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1120758874 14:88268587-88268609 TCCTATTTTTTGGGATAAAAGGG - Intronic
1120859879 14:89245729-89245751 CTCCACTTTTTTGGAGAAAAAGG - Intronic
1121370012 14:93347752-93347774 ATCTAGCGTTTTCGATAAAATGG + Intronic
1121388823 14:93556705-93556727 ATCTTGTTTTTTTGAAAAAAAGG - Intronic
1121389765 14:93564049-93564071 GTCAAGTTGTTTGGACAAAAAGG + Intronic
1121703898 14:95976752-95976774 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1121980389 14:98449394-98449416 GTCAAATTGTTTGGATAAAAAGG + Intergenic
1122112544 14:99512523-99512545 AGCTAGTAACTTGGATAAAAAGG + Exonic
1122381073 14:101307625-101307647 GTCAAGTTGTTTGGATAAAGAGG + Intergenic
1122507885 14:102243420-102243442 ATCAAGTTGTTTGGACAAAAAGG - Intronic
1124961014 15:34394977-34394999 ATCTAATATTTTGGATATTATGG - Intronic
1124977644 15:34541198-34541220 ATCTAATATTTTGGATATTATGG - Intronic
1125129586 15:36267525-36267547 ATCTAGTGTTATTTATAAAATGG + Intergenic
1125163978 15:36680717-36680739 CTCTACTTTCTTGGAGAAAATGG + Intronic
1126749315 15:51860627-51860649 ATGTAGTTTTTTGTAAGAAATGG - Intronic
1127234213 15:57030419-57030441 ATTTATTTTTTTGTAGAAAATGG + Intronic
1127421428 15:58810115-58810137 ATTGAATTTATTGGATAAAATGG + Intronic
1129259673 15:74357728-74357750 GTCAAGTTGTTTGGATAGAAAGG - Intronic
1130164023 15:81434334-81434356 ATCTAGAATTTGGGAGAAAACGG - Intergenic
1130781313 15:87043450-87043472 GTCAAATTGTTTGGATAAAAAGG - Intergenic
1130945701 15:88549410-88549432 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1131447981 15:92515304-92515326 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1134405177 16:13951358-13951380 TACAAGTTTTTTGTATAAAAAGG + Exonic
1135802781 16:25514003-25514025 ATGGAATTTTATGGATAAAAAGG + Intergenic
1137276910 16:46941051-46941073 AAATATTTTTTAGGATAAAAAGG + Intergenic
1138950078 16:61901875-61901897 ACCCAGTTTTTTAAATAAAAAGG - Intronic
1139045385 16:63051928-63051950 ATTTTGATTTTTGGAAAAAATGG - Intergenic
1139998303 16:71001524-71001546 CTCTAGTCTCTTAGATAAAATGG - Intronic
1140510367 16:75503167-75503189 GTCTAGTTTTTTTATTAAAAAGG + Intergenic
1143989256 17:10942801-10942823 TTCTAGATTTGTGGATATAATGG + Intergenic
1144277491 17:13687997-13688019 CTCTAGTTTTTTTAATAATATGG + Intergenic
1145394742 17:22486290-22486312 AAATAGTTCTTTGGGTAAAAAGG - Intergenic
1146200706 17:30855528-30855550 CTCAAGTTTCTTGTATAAAATGG + Intronic
1151898262 17:76994954-76994976 TTTTTGTTTTTTGTATAAAAAGG - Intergenic
1203172575 17_GL000205v2_random:162721-162743 TTCAAGTTTTTTGTATAAATGGG - Intergenic
1203173145 17_GL000205v2_random:170061-170083 TTCAAGTTTTTTGTATAAATGGG + Intergenic
1154037587 18:10819274-10819296 ATACTGTTTTTTGGATAAAGAGG + Intronic
1155015913 18:21839349-21839371 ACTTAGATTTTTGAATAAAAAGG - Intronic
1155174072 18:23287850-23287872 GTCAAGTTGTTTGGACAAAAAGG - Intronic
1156237605 18:35219568-35219590 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1156251688 18:35358238-35358260 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
1156302498 18:35847722-35847744 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1156784026 18:40887900-40887922 TCCTAGTTTCTTGAATAAAAAGG + Intergenic
1156794305 18:41023637-41023659 ATGTAGTTCTTTTGGTAAAAAGG + Intergenic
1156958435 18:42994680-42994702 GTCAAGTTGTTTGGACAAAAAGG - Intronic
1157282136 18:46353145-46353167 CTATAGTCTTTTGGATAAGATGG - Intronic
1157637153 18:49169878-49169900 ATCTCTTTATTTGGATAATATGG - Intronic
1157829594 18:50845018-50845040 ATCTAGTTTATTGCATTTAAGGG + Intergenic
1157944021 18:51958629-51958651 ATCTAGTTGTTTTGAAAAATAGG - Intergenic
1158336586 18:56419186-56419208 ATCAAGTTGTTTGGACAGAAAGG - Intergenic
1159420597 18:68214197-68214219 AACTAATTATTTGGATAAAGTGG + Intergenic
1159479101 18:68964422-68964444 CTCTATTTCTTTGGATGAAAAGG + Intronic
1160088819 18:75806821-75806843 ATATATTATTTTGGTTAAAAAGG - Intergenic
1163209937 19:15832778-15832800 GTCAAGTTGTTTGGATAGAAAGG - Intergenic
1163899940 19:20092362-20092384 GTCAAGTTGTTTGGACAAAAAGG + Intronic
1164541888 19:29127657-29127679 ATCTAGTTTGTTAAATAAAACGG - Intergenic
1164659762 19:29953256-29953278 ATTCAGTTTTTTGGTTACAATGG + Intronic
1165658957 19:37557934-37557956 ATCCAGTTTCTTAGATAAATAGG + Intronic
1166629408 19:44391939-44391961 ATCCAATGTTTTGGATAAACCGG - Intronic
1166926887 19:46275243-46275265 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
1167901379 19:52624698-52624720 GTCAAGTTGTTTGGACAAAAAGG - Intronic
1168211914 19:54897016-54897038 ATCAAGTTGTTTGGACAGAAAGG + Intergenic
925517922 2:4705604-4705626 ATCAAAGTTTTTGGATAAGAGGG - Intergenic
925544761 2:5004571-5004593 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
925560800 2:5192504-5192526 ATTTAGTTTTTTCTACAAAAAGG + Intergenic
927019595 2:19002893-19002915 GTCTAGGTTTTTGGCTCAAATGG - Intergenic
927134406 2:20086115-20086137 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
928857382 2:35816674-35816696 GTCAAGTTTTTTGGATAAAAAGG - Intergenic
928980609 2:37132196-37132218 ATTTGGTGTTTGGGATAAAAGGG - Intronic
929004592 2:37382909-37382931 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
929272638 2:39989689-39989711 ATGTACTTATTTTGATAAAAAGG + Intergenic
929526729 2:42710770-42710792 ATGTAATTTTTTAAATAAAATGG + Intronic
930487113 2:52024016-52024038 GTCAAGTTGTTTGGGTAAAAAGG + Intergenic
931265787 2:60659109-60659131 ACCTAGTTATTTAAATAAAATGG + Intergenic
931948497 2:67335403-67335425 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
932159186 2:69445395-69445417 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
932296087 2:70624414-70624436 GTCAAGTTGTTTGGACAAAAAGG - Intronic
932973706 2:76575758-76575780 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
933247197 2:79989029-79989051 TTCCAGTATGTTGGATAAAACGG + Intronic
933710831 2:85324753-85324775 TTCTAGTTTGTTGTCTAAAAAGG + Intronic
936839501 2:116752979-116753001 GTCTAGTCATTAGGATAAAAAGG - Intergenic
936978621 2:118243287-118243309 TTCTAGATCTTTGCATAAAATGG - Intergenic
937594730 2:123659852-123659874 ATCAAGTTGTTTGGACAGAAAGG + Intergenic
939895670 2:147788194-147788216 ATCTAGGTTTGTAGTTAAAAAGG - Intergenic
939940118 2:148339264-148339286 ATCTTGTTTTTTTCACAAAAAGG + Intronic
940107592 2:150116404-150116426 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
940183971 2:150962271-150962293 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
940530399 2:154870905-154870927 GTCAAGTTGTATGGATAAAAAGG - Intergenic
941455926 2:165712243-165712265 ATCAAGTTGTTTGGACAAAAAGG + Intergenic
941641106 2:167989407-167989429 AACTGGTTCTTTGGAGAAAATGG - Intronic
941935649 2:170979549-170979571 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
942361716 2:175179963-175179985 ATCTAGTTTTTTGGATAAAAGGG + Intronic
942794106 2:179795930-179795952 GTCTATTTTTTTGGTTTAAATGG - Intronic
942866585 2:180683436-180683458 ATCCAGTTTTTTAGATTTAAAGG - Intergenic
943176093 2:184476424-184476446 ATTTAGTTTTTTAGAAAAAATGG - Intergenic
943377680 2:187099907-187099929 ATCTAGTGTTTTAGAAAGAAAGG + Intergenic
943450381 2:188037030-188037052 GTCAAGTTGTTGGGATAAAAAGG - Intergenic
943453826 2:188078110-188078132 ATCTAGGTTCTTGGAAAATATGG + Intergenic
943485017 2:188468537-188468559 ATCTAGTTTTTTCAAAATAATGG - Intronic
943593805 2:189831064-189831086 ATTTGGTTATGTGGATAAAATGG + Intronic
943816232 2:192259427-192259449 AAGTAGTTATTTGGAAAAAAGGG - Intergenic
943865584 2:192921861-192921883 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
943951057 2:194132795-194132817 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
944251305 2:197582072-197582094 GTCAAGTTGTTTGGACAAAATGG - Intronic
945173722 2:207021208-207021230 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
945301212 2:208217979-208218001 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
945361850 2:208902819-208902841 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
946041619 2:216787715-216787737 ATCTGGTCTTTTACATAAAATGG + Intergenic
946873773 2:224108185-224108207 ATGGAGTTTATTGGACAAAAAGG + Intergenic
947470341 2:230395866-230395888 ATCTTGTGATTTGGATAGAAGGG + Intronic
948576440 2:238954595-238954617 ATCTACTATTTTGGAAAAACTGG - Intergenic
1169491745 20:6076946-6076968 CTCTTGTTTTTTCTATAAAATGG - Exonic
1169525635 20:6422389-6422411 ATAGAGGTTTTTGGAGAAAATGG + Intergenic
1170305630 20:14934776-14934798 ATCTTGTTTTTTGGAGACAGAGG - Intronic
1170680193 20:18519510-18519532 GTCAAGTTGTTTGGACAAAAAGG + Intronic
1172932200 20:38594456-38594478 GTCAAGTTGTTTGGACAAAAGGG + Intergenic
1173205358 20:40989050-40989072 CTCAAGTTTTTTACATAAAATGG + Intergenic
1174923488 20:54730792-54730814 ATATAATTTCTTGGAGAAAATGG + Intergenic
1175275376 20:57765099-57765121 ATCTATATTGTTGAATAAAAGGG + Intergenic
1176328569 21:5524507-5524529 TTCAAGTTTTTTGTATAAATGGG - Intergenic
1176329128 21:5531703-5531725 TTCAAGTTTTTTGTATAAATGGG + Intergenic
1176398629 21:6289248-6289270 TTCAAGTTTTTTGTATAAATGGG - Intergenic
1176399188 21:6296444-6296466 TTCAAGTTTTTTGTATAAATGGG + Intergenic
1176437969 21:6692660-6692682 TTCAAGTTTTTTGTATAAATGGG - Intergenic
1176438528 21:6699856-6699878 TTCAAGTTTTTTGTATAAATGGG + Intergenic
1176462231 21:7019730-7019752 TTCAAGTTTTTTGTATAAATGGG - Intergenic
1176462790 21:7026926-7026948 TTCAAGTTTTTTGTATAAATGGG + Intergenic
1176485792 21:7401508-7401530 TTCAAGTTTTTTGTATAAATGGG - Intergenic
1176486351 21:7408704-7408726 TTCAAGTTTTTTGTATAAATGGG + Intergenic
1177030925 21:15981709-15981731 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
1177100890 21:16896131-16896153 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1177645747 21:23898331-23898353 AGGTAGTTTTGTAGATAAAAGGG - Intergenic
1177840510 21:26229961-26229983 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
1179650121 21:42802950-42802972 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
1180516979 22:16153583-16153605 AGCTAATTTTTTGGATAAAGTGG - Intergenic
1180557126 22:16587075-16587097 ATTTATTTTTTTGTAGAAAAGGG + Intergenic
1181943033 22:26493686-26493708 ATCTACTTTATAGGCTAAAAGGG - Exonic
1182617737 22:31599645-31599667 TTCTAATTTTTTGTAGAAAAAGG + Intronic
1183432462 22:37774096-37774118 ATAAAGTGTTTTGGAAAAAAAGG - Exonic
1183635383 22:39059203-39059225 GTCAAGTTGTTTGGACAAAAAGG + Intronic
1183754250 22:39744900-39744922 ATGTAATTTTATGGAAAAAAAGG - Intronic
1184223774 22:43117255-43117277 AGCTAGTAACTTGGATAAAAAGG - Intronic
949148410 3:732900-732922 ATGTATTTTTTTAGAGAAAAAGG - Intergenic
949595524 3:5541505-5541527 TTCAATTTTTTTGGATAAATTGG + Intergenic
949720060 3:6978491-6978513 ATTTAATTGTTTGGATCAAATGG - Intronic
950908750 3:16565324-16565346 ATCTAGCTTTTTGGTTTTAATGG - Intergenic
951316075 3:21191106-21191128 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
951478278 3:23131639-23131661 ATATAGTATTTTTTATAAAAAGG - Intergenic
951762543 3:26162285-26162307 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
951894858 3:27600951-27600973 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
952022633 3:29041385-29041407 ATCTGGTTATTTGGAGAAAGAGG - Intergenic
952297140 3:32071542-32071564 GTCAAGTTGTTTGGACAAAAAGG - Intronic
952306237 3:32149006-32149028 ATCTAGTTTTTGTTTTAAAAAGG - Intronic
952343360 3:32463538-32463560 GTCAAGTTGTTTGGATAAAAAGG + Intronic
952894955 3:38072410-38072432 GTCAAGTTGTTTGGACAAAAAGG + Intronic
953656290 3:44857425-44857447 GTCAAGTTGTTTGGACAAAAAGG + Intronic
953689505 3:45106163-45106185 ATCTTGTTTTTTGGACAATTAGG + Intronic
953825490 3:46248429-46248451 ATCAAGTTGTTTGGACAGAAAGG + Intronic
955253619 3:57307467-57307489 GTCAAGTTGTTTGGATAAAAAGG - Intronic
955626006 3:60920119-60920141 ATTTAATTTTTTCAATAAAATGG + Intronic
956061225 3:65350022-65350044 ATATAGTTTTTATGAAAAAATGG - Intergenic
956709460 3:72026791-72026813 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
956817966 3:72925675-72925697 AGCTAATATTTTGGATAGAATGG - Intronic
956948174 3:74248416-74248438 TTCTAGATTTTTGTTTAAAATGG + Intergenic
957238133 3:77621418-77621440 ATTTAATTTTTTGGAGAGAAGGG - Intronic
957284029 3:78193404-78193426 CTCAAGTTCTTTGTATAAAATGG - Intergenic
957675061 3:83355432-83355454 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
957904588 3:86540126-86540148 GTCAAGTTATTTGGACAAAAAGG + Intergenic
957985961 3:87573288-87573310 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
958422206 3:93941715-93941737 GTCAAGTTGTTTGGACAAAAAGG - Intronic
958633902 3:96717745-96717767 ATCTTGTTTTTAAGAAAAAAGGG - Intergenic
959063775 3:101637607-101637629 ATCCAGTCTTTTAGATAAACAGG - Intergenic
959831186 3:110864587-110864609 AGCTAGTTTTTATGATGAAATGG + Intergenic
960334741 3:116402780-116402802 ATCTAGTATTTTGTATTACATGG - Intronic
961293728 3:125867395-125867417 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
961892349 3:130140786-130140808 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
962660880 3:137599278-137599300 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
963058871 3:141208751-141208773 GCCAAGTTGTTTGGATAAAAAGG - Intergenic
963363626 3:144306804-144306826 ACCAAGTTTCTTGTATAAAATGG + Intergenic
963520683 3:146357354-146357376 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
963521865 3:146365857-146365879 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
964068104 3:152601038-152601060 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
964300990 3:155284725-155284747 GTCAAGTTGTTTGGATAGAAAGG + Intergenic
964659880 3:159108448-159108470 ATTTAATTTCTTGGATCAAAGGG + Intronic
965262406 3:166502690-166502712 GTCAAGTTATTTGGACAAAAAGG + Intergenic
965335366 3:167426560-167426582 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
965336577 3:167435019-167435041 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
965861742 3:173157867-173157889 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
966067070 3:175831477-175831499 GTCAAGTTATTTGGACAAAAAGG - Intergenic
966085674 3:176065130-176065152 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
966279547 3:178211335-178211357 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
967234681 3:187372738-187372760 ATCTATTTTTTGGGAAAGAATGG + Intergenic
967624412 3:191668395-191668417 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
967905057 3:194492397-194492419 CTCAAGTTTCTTGGATAAAAGGG + Intronic
969003579 4:4002170-4002192 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
969750427 4:9106356-9106378 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
970028983 4:11655652-11655674 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
970124199 4:12791148-12791170 ATCTGGTTTTATGGGTAAAATGG - Intergenic
971366420 4:25981252-25981274 ATCTATTTTTATGGAAGAAAGGG - Intergenic
971911925 4:32805095-32805117 ATATAGTCATTTGGATAACAAGG + Intergenic
973191716 4:47393002-47393024 ATTTAGTTTTCTGGATTAGATGG + Intronic
974555448 4:63440951-63440973 TTGTAGTTTTGTGGATAAATTGG - Intergenic
975017260 4:69437753-69437775 ATCTAGCTATTAGGAGAAAAAGG - Intergenic
975205784 4:71642950-71642972 ATCTAGTTGTTTGGAGAGATAGG - Intergenic
975257218 4:72252308-72252330 AAATAGTTTTTTATATAAAAAGG + Intergenic
975420778 4:74161616-74161638 ATCAAGATTTTTGACTAAAATGG + Intronic
975425980 4:74228102-74228124 ATGTAATTTTTTGGAAAAACAGG - Intronic
976558813 4:86478383-86478405 GTCAAGTTGTTTGGATAAAAAGG - Intronic
976719357 4:88154948-88154970 GTCAAGTTGTTTGGACAAAAAGG + Intronic
977782194 4:100993690-100993712 ATCAAGTTGTTTGGATAGAAAGG + Intergenic
978031727 4:103944937-103944959 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
979171164 4:117602224-117602246 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
979243522 4:118471516-118471538 AGCAAGTTTTGTGGAGAAAATGG + Intergenic
979922464 4:126516806-126516828 CCCTAGTTGTTTGAATAAAAAGG + Intergenic
980285185 4:130771164-130771186 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
980302356 4:131011106-131011128 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
980472194 4:133265611-133265633 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
980528074 4:134015756-134015778 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
981891545 4:149744531-149744553 GGCTAGTTTTTTGCATTAAAAGG - Intergenic
982319083 4:154060239-154060261 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
982535652 4:156603873-156603895 ATCAAGTTGTTTGGACAGAAAGG - Intergenic
982694815 4:158587817-158587839 ATGTAGTTATGAGGATAAAATGG + Intronic
982844814 4:160237285-160237307 ATCTAGTTGTCTGGATAAAGAGG + Intergenic
982898662 4:160968966-160968988 ATGTAATTTTTTAGAAAAAATGG + Intergenic
983002294 4:162431647-162431669 ATGTAGTTTTTAGAAAAAAATGG - Intergenic
983056369 4:163102689-163102711 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
983197273 4:164821154-164821176 ATCAAATTTTTGGGAAAAAAAGG - Intergenic
983448265 4:167879912-167879934 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
983707908 4:170681288-170681310 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
983917128 4:173304118-173304140 GGTGAGTTTTTTGGATAAAAGGG + Exonic
984420046 4:179509595-179509617 ATTTAATAATTTGGATAAAACGG - Intergenic
984437508 4:179724247-179724269 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
985057156 4:186046111-186046133 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
985108727 4:186525329-186525351 ATTTATTTTTTTGGATAATGTGG - Intronic
985435951 4:189929655-189929677 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
985797855 5:1976898-1976920 ATTTAGTTTTTTGGAGATCAGGG - Intergenic
986368708 5:7060057-7060079 GTCAAGTTATTTGGACAAAAAGG + Intergenic
986471234 5:8078155-8078177 ATCTACTTTGTTGAATATAAGGG - Intergenic
986554804 5:9000455-9000477 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
986562209 5:9072117-9072139 TTTTTGTTATTTGGATAAAAGGG - Intronic
986905976 5:12493338-12493360 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
987001743 5:13666844-13666866 ATCTAGTCTTTTGGTTAAACGGG + Intergenic
987514566 5:18888872-18888894 AGCTAGTGTTTTGGCTAAAATGG - Intergenic
987651165 5:20741732-20741754 AGCTGGTTTTCAGGATAAAATGG + Intergenic
987995645 5:25274867-25274889 ATCTTATTTTTTAGTTAAAACGG + Intergenic
988372631 5:30391008-30391030 TTCTACTTATTTGGACAAAAAGG - Intergenic
988444859 5:31274508-31274530 ATTTAGTTTGTTGAACAAAAGGG + Intronic
988744398 5:34119717-34119739 AGCTGGTTTTCAGGATAAAATGG - Intronic
989141849 5:38209318-38209340 ATCTATTTTATTGCATTAAATGG - Intergenic
989614904 5:43329684-43329706 GTCAAGTTGTTTGGATAGAAAGG + Intergenic
990246507 5:53868445-53868467 ATATGGCTTTTTGGACAAAAAGG - Intergenic
990635184 5:57717914-57717936 AGCTATTTTTAAGGATAAAAAGG - Intergenic
990783099 5:59388701-59388723 ATCTTTTATTTTGGATAGAATGG + Intronic
991188766 5:63843716-63843738 ATCCAGTATTTTGAAAAAAACGG + Intergenic
991215965 5:64157611-64157633 ATCTAGAATTTTTGACAAAAAGG - Intergenic
992061515 5:73053237-73053259 ATGTATTTGTTTGGAAAAAAAGG + Intronic
992451748 5:76882291-76882313 GTCAAGTTGTTTGGATAAAAAGG + Intronic
992590496 5:78291039-78291061 ACCTAATTTATTGGCTAAAAAGG - Intronic
992818242 5:80466650-80466672 TCCTATTTCTTTGGATAAAAGGG + Intronic
992961075 5:81957084-81957106 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
993120495 5:83768462-83768484 ATCTTGTGTTTTTGATAAAAAGG + Intergenic
993206835 5:84892719-84892741 ATCTATTTTGTCTGATAAAAAGG + Intergenic
993830302 5:92748566-92748588 ATATAGTTTATTGGAAGAAATGG + Intergenic
994125886 5:96169007-96169029 GTCAAGTTGTTTGCATAAAAAGG + Intergenic
994206968 5:97046169-97046191 TTCTAGATTTCTGGAAAAAATGG - Intergenic
994269131 5:97756005-97756027 ATGTAGCTGTTTGAATAAAAAGG - Intergenic
994295354 5:98082657-98082679 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
995291856 5:110466081-110466103 ATATAGCTGTTTGGATAGAAAGG + Intronic
996483925 5:124008390-124008412 AGCTAGTATTTTGGACAACACGG + Intergenic
997477204 5:134150540-134150562 ATCTAGTTAATTGTATAAAAAGG + Exonic
997678597 5:135733645-135733667 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
999862659 5:155665279-155665301 ATTTAGCTTGTTGGATAAATGGG - Intergenic
1000250090 5:159485958-159485980 AGCTAGTTTTGAAGATAAAATGG + Intergenic
1000289703 5:159859006-159859028 GTCTATTTGTTTGAATAAAATGG - Intergenic
1000701727 5:164459054-164459076 ATCCAGTTTTCTGGATTCAAAGG - Intergenic
1000703555 5:164483030-164483052 ATCTAGGTATCAGGATAAAAAGG + Intergenic
1000918690 5:167113214-167113236 ATCTAGTTATTTGGGAGAAAAGG + Intergenic
1001464987 5:171956140-171956162 CTCTATTTTTCTGGATTAAAAGG - Intronic
1003100010 6:3169830-3169852 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1004837244 6:19542704-19542726 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1004886727 6:20058482-20058504 ATTTAGTTTTATGTTTAAAAAGG + Intergenic
1005067309 6:21830962-21830984 ATATCATTTTTTGGATAAAATGG - Intergenic
1005175337 6:23038273-23038295 ATCTAGCTTTTTCCAGAAAAAGG + Intergenic
1005927427 6:30455105-30455127 GTCAAGTTGTTTGGAAAAAAAGG - Intergenic
1005930944 6:30483389-30483411 TTCAAGTTGTTTGGAAAAAAAGG - Intergenic
1006325043 6:33347248-33347270 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1007300723 6:40866018-40866040 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1008476835 6:51942303-51942325 GTCAAGTTGTTTGGATAAAAAGG - Intronic
1008655292 6:53605873-53605895 TTCAACTTTTCTGGATAAAAAGG + Intronic
1009270012 6:61603540-61603562 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1009379333 6:63008762-63008784 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1009485947 6:64221777-64221799 ATCAAGTTTCTTATATAAAATGG - Intronic
1009672352 6:66772563-66772585 CTTTAGTTGTTTGGAGAAAAAGG - Intergenic
1009751803 6:67885535-67885557 ATCAAGCTGTTTGGATAAATAGG + Intergenic
1010071478 6:71750463-71750485 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
1010959543 6:82130078-82130100 AAGTAGTTATTTGGACAAAACGG - Intergenic
1011350429 6:86416946-86416968 ATCTCTTTTTTTGGATTAACTGG + Intergenic
1011367655 6:86600284-86600306 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
1011808464 6:91100035-91100057 TTCTATTTTTTTAGATATAAAGG + Intergenic
1012385927 6:98682792-98682814 ATCTATTTTTTTTAAAAAAAAGG + Intergenic
1012769299 6:103408601-103408623 ATATATTTTTGTAGATAAAAAGG + Intergenic
1014115080 6:117661462-117661484 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1014236868 6:118967771-118967793 ATCTTGTTTTCAGGATATAAAGG + Intronic
1014508996 6:122297251-122297273 TTCTAGTTTTTTATTTAAAATGG + Intergenic
1014582184 6:123152359-123152381 AACCAGTTTTTAGGGTAAAAGGG - Intergenic
1015165446 6:130196117-130196139 GTCAAGTTGTTTGGACAAAAAGG - Intronic
1016204770 6:141456614-141456636 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1016249105 6:142019608-142019630 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1016751245 6:147632613-147632635 CTCAAGTTTTTTGGATAAAAAGG + Intronic
1017922614 6:158885312-158885334 ATCAAGTTGTTTGGGCAAAAAGG + Intronic
1018077805 6:160231930-160231952 GTCAAGTTGTTTGGATAAAAGGG - Intronic
1018135963 6:160778681-160778703 GTCAAATTGTTTGGATAAAAAGG - Intergenic
1018566435 6:165159581-165159603 ATGTAGTTTTTTTGATAAGAAGG - Intergenic
1018991701 6:168678738-168678760 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1020322555 7:6950282-6950304 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1020540896 7:9460459-9460481 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1021195076 7:17665608-17665630 CTCTTGTTTTTTTGAAAAAAAGG + Intergenic
1021320631 7:19206424-19206446 ATTGAGTTTATTGAATAAAATGG + Intergenic
1021352238 7:19609253-19609275 ATCTAGCTTGTTGGATAAAAAGG + Intergenic
1021359649 7:19695241-19695263 ATCTACTTTTTGAGAAAAAAAGG + Intergenic
1021393862 7:20124392-20124414 GTCAAGTTGTTCGGATAAAAAGG - Intergenic
1021637592 7:22707207-22707229 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1021738081 7:23658460-23658482 AGCTAATTTATTGGATAAAGCGG - Intergenic
1022572551 7:31468944-31468966 GTCAAGTTGTTTGGACAAAATGG + Intergenic
1022709317 7:32836162-32836184 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1027158587 7:75785890-75785912 GTCAAGTTGTTTGGACAAAAAGG - Intronic
1027354615 7:77343116-77343138 ATCAAGTTGTTTGGACAGAAAGG - Intronic
1028017925 7:85738399-85738421 AGCTAGTTCATTGGATAAAGTGG + Intergenic
1028589630 7:92481528-92481550 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1029317438 7:99727231-99727253 GTCAAGTTGTTTGGACAAAAAGG - Intronic
1029500456 7:100925958-100925980 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1029901133 7:104041090-104041112 ATCTAGTTTTATGTGGAAAAAGG - Intergenic
1029960253 7:104682654-104682676 AACAAGTTTTTTGGATAAATGGG + Intronic
1030163368 7:106530345-106530367 GTCAGGTTGTTTGGATAAAAAGG + Intergenic
1030445598 7:109644452-109644474 ATCAAGTTGTTTGGACAGAAAGG + Intergenic
1030766280 7:113413689-113413711 ATCTACTTTTTTAGGTAATATGG - Intergenic
1031095683 7:117417012-117417034 ATCTTAGTTTTTAGATAAAATGG - Intronic
1031160407 7:118160764-118160786 ATCTTGTTTTTTTGGGAAAAAGG - Intergenic
1031296854 7:120012680-120012702 GCCTAGTTGTTTGGATAAAAAGG - Intergenic
1031422205 7:121565733-121565755 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1031704362 7:124962545-124962567 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1031777579 7:125921372-125921394 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1032443086 7:131957274-131957296 ATCTATTTTTGAGGAAAAAAGGG + Intergenic
1032692906 7:134306840-134306862 ATATATATTTTTGGCTAAAAAGG + Intronic
1033316484 7:140301696-140301718 AAATATTTATTTGGATAAAATGG - Intronic
1033464798 7:141580738-141580760 GTCAAGTTGTTTGGATAAAAAGG + Intronic
1033527335 7:142229313-142229335 AATTAGTTATTTGAATAAAAGGG + Intergenic
1034105875 7:148489275-148489297 ATATATTTTTTTTTATAAAAAGG - Intergenic
1034334410 7:150311311-150311333 GTCAAGTTGTTTGGATAGAAAGG - Intronic
1034620192 7:152450925-152450947 ATTTATTTTTTTGTAGAAAAGGG - Intergenic
1035012955 7:155736802-155736824 ATTTAGTGTTTTGGATTAATGGG + Intronic
1035139909 7:156749580-156749602 TTTTATTTTTTAGGATAAAAAGG + Intronic
1036373490 8:8180688-8180710 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1036877415 8:12484953-12484975 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1037841382 8:22247633-22247655 ATCTATATTTTTGGACAAGAAGG + Intronic
1037902604 8:22696255-22696277 TACTAGTTCTTTGCATAAAACGG + Intergenic
1039436757 8:37564672-37564694 TTCTTGTTTTTAGGCTAAAATGG - Intergenic
1040648255 8:49423327-49423349 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1041651600 8:60308405-60308427 ATCAAGTTGTTTAGACAAAAAGG + Intergenic
1042706330 8:71668114-71668136 GTCAAGTTGTTTGGATTAAAAGG - Intergenic
1042914475 8:73861818-73861840 ATTTTGTTTGTTGTATAAAATGG + Intronic
1043321304 8:78989917-78989939 ATCAAATTCTTTAGATAAAAAGG + Intergenic
1043473424 8:80583358-80583380 ATATTTTATTTTGGATAAAAGGG + Intergenic
1043599096 8:81917248-81917270 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1043837944 8:85066560-85066582 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1044235726 8:89827874-89827896 ATCTAGTTTTTTACATAGAAAGG + Intergenic
1045027880 8:98106716-98106738 ATATTGTTTTTTTGAGAAAAAGG - Intronic
1045161091 8:99545015-99545037 ATATAGTTGTTTCAATAAAAAGG - Intronic
1045970865 8:108078671-108078693 ATATAGTTTCTTCCATAAAAAGG - Intronic
1046165820 8:110433445-110433467 AGATACTGTTTTGGATAAAAGGG - Intergenic
1046512289 8:115215816-115215838 GTCAAGTTTTTTGGACAGAAAGG - Intergenic
1047676792 8:127211406-127211428 ATGTAGTATTTTGCACAAAATGG + Intergenic
1047680566 8:127250168-127250190 AACTAGTTTCCTGGGTAAAATGG - Intergenic
1048135701 8:131744522-131744544 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1048144003 8:131822989-131823011 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1048728184 8:137410188-137410210 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1049868558 8:144956007-144956029 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1050117856 9:2279361-2279383 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1050188817 9:3003522-3003544 CTCAAGTTTCTTGTATAAAATGG - Intergenic
1050257850 9:3813078-3813100 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1050952695 9:11618130-11618152 ATTTAGCATTTTCGATAAAATGG - Intergenic
1051770004 9:20567230-20567252 ATTTAGATTCTTGGAGAAAAGGG - Intronic
1052163320 9:25291479-25291501 GTCAAGTTGTTTGGATATAAAGG - Intergenic
1052502891 9:29315821-29315843 ATCTCTGTTTTTAGATAAAATGG + Intergenic
1053056191 9:34994291-34994313 ATTTAGTTTTGAGGATAGAAAGG - Intronic
1053059727 9:35021625-35021647 GTCAAGTTGTTTGGATAAAAAGG + Intergenic
1054807240 9:69406662-69406684 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1055352346 9:75402638-75402660 ATGAATTTTTTTGGAGAAAAAGG - Intergenic
1055626970 9:78184610-78184632 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1056016561 9:82394631-82394653 ATGTAGTCTTTTGGTTCAAAGGG - Intergenic
1057299170 9:93866536-93866558 AAATAGTTTTTTAAATAAAAAGG + Intergenic
1057812337 9:98267728-98267750 GTCAAATTGTTTGGATAAAAAGG + Intergenic
1057921387 9:99100911-99100933 CTCCATTTTTTTTGATAAAAAGG - Intergenic
1058612638 9:106792144-106792166 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1059863247 9:118487582-118487604 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1060546034 9:124459810-124459832 CTCAAGTTTTTTATATAAAATGG - Intronic
1060737629 9:126076536-126076558 GTCAAGTTTTTTGGACAAAAAGG + Intergenic
1061278029 9:129580797-129580819 ATCCACTTTTGTGGCTAAAATGG + Intergenic
1061840349 9:133355211-133355233 ATCTAGATTCTTGAGTAAAAAGG - Intronic
1203432968 Un_GL000195v1:108620-108642 TTCAAGTTTTTTGTATAAATGGG - Intergenic
1203433538 Un_GL000195v1:115961-115983 TTCAAGTTTTTTGTATAAATGGG + Intergenic
1186275672 X:7935639-7935661 ATATAGTTTTATGTATCAAAAGG - Intergenic
1186300030 X:8190539-8190561 CTCTAGTTCATTTGATAAAATGG + Intergenic
1187193889 X:17062737-17062759 ATCCAGTTTTAGGGAGAAAAGGG - Intronic
1188065218 X:25650711-25650733 ATATAGCTTTTGGGCTAAAAAGG - Intergenic
1188266799 X:28086850-28086872 ATTTTGTTTTCTGGAAAAAAGGG + Intergenic
1188419746 X:29979128-29979150 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1188431271 X:30107144-30107166 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1188463147 X:30451027-30451049 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1188552903 X:31381301-31381323 GTCAAGTTGTTTGGATAAAAAGG - Intronic
1188908421 X:35816185-35816207 ATCTAATTTTTTAGATAATAGGG - Intergenic
1188994854 X:36871370-36871392 CTCTATTTTTTTCAATAAAAAGG - Intergenic
1191761551 X:64652865-64652887 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1191825819 X:65363698-65363720 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1193517197 X:82480671-82480693 ATTTATTTTTTTGTATAAATGGG - Intergenic
1194271271 X:91819462-91819484 TTTTAGGTTTTTGAATAAAATGG + Intronic
1194577476 X:95630450-95630472 ATTGTGTTTTTTTGATAAAAAGG + Intergenic
1194660924 X:96627830-96627852 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1194695399 X:97043049-97043071 ACATTGTTTTTTGGTTAAAAAGG + Intronic
1194770400 X:97896878-97896900 ATCTAACTTTTTAGATAAAAGGG - Intergenic
1194873555 X:99161365-99161387 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1195326611 X:103763689-103763711 CTCAAGTTGTTTGGATAAAAAGG + Intergenic
1195891559 X:109701126-109701148 TTCTAGGTGGTTGGATAAAAAGG - Intronic
1196010995 X:110887888-110887910 AACTACTATTGTGGATAAAAAGG - Intergenic
1196767534 X:119261678-119261700 ATCAAGAATGTTGGATAAAATGG + Intergenic
1196992433 X:121344909-121344931 GTCAAGTTGTTTGGACAAAAAGG + Intergenic
1197471213 X:126866876-126866898 GTCAAGTTGTTTGGATAAAAAGG - Intergenic
1197499956 X:127230391-127230413 GTCAAGTTGTTTGGATAAAAGGG - Intergenic
1197796403 X:130303510-130303532 ATCTATTTTTATGGACTAAAAGG - Intergenic
1198441393 X:136666767-136666789 TTCTAGTTTCTGGGATAAAGTGG + Exonic
1199210093 X:145198024-145198046 ATCCAATATTTTGGATAAAATGG + Intergenic
1199898493 X:152149622-152149644 ATCTGTTTTATTGGACAAAAAGG + Intergenic
1200386727 X:155899394-155899416 AAATAGTTTCATGGATAAAAGGG - Intronic
1200588514 Y:5040900-5040922 CTTTAGGTTTTTGAATAAAATGG + Intronic
1200776992 Y:7178297-7178319 AGCTAGTTCATTGGATAAAGTGG + Intergenic
1200813081 Y:7504534-7504556 GTCAAGTTGTTTGGACAAAAAGG - Intergenic
1201385803 Y:13438349-13438371 GTCTAGTTGTTTAGATAAATAGG - Intronic
1201926300 Y:19291711-19291733 CTCCAGTTTCTTGTATAAAAAGG + Intergenic
1201937388 Y:19422933-19422955 GTCAAGTTGTTTGGACAAAAAGG - Intergenic