ID: 942366244

View in Genome Browser
Species Human (GRCh38)
Location 2:175230874-175230896
Sequence ACTGCCAGACATACAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942366240_942366244 13 Left 942366240 2:175230838-175230860 CCCGTTATAGAACGTAAGGTATG No data
Right 942366244 2:175230874-175230896 ACTGCCAGACATACAGTGGAGGG No data
942366239_942366244 14 Left 942366239 2:175230837-175230859 CCCCGTTATAGAACGTAAGGTAT No data
Right 942366244 2:175230874-175230896 ACTGCCAGACATACAGTGGAGGG No data
942366241_942366244 12 Left 942366241 2:175230839-175230861 CCGTTATAGAACGTAAGGTATGA No data
Right 942366244 2:175230874-175230896 ACTGCCAGACATACAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942366244 Original CRISPR ACTGCCAGACATACAGTGGA GGG Intergenic
No off target data available for this crispr