ID: 942372513

View in Genome Browser
Species Human (GRCh38)
Location 2:175300460-175300482
Sequence CTACCTACAGAGAAGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942372513_942372518 -7 Left 942372513 2:175300460-175300482 CCCTCCCACTTCTCTGTAGGTAG No data
Right 942372518 2:175300476-175300498 TAGGTAGCAGGCATGTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942372513 Original CRISPR CTACCTACAGAGAAGTGGGA GGG (reversed) Intergenic
No off target data available for this crispr