ID: 942379439

View in Genome Browser
Species Human (GRCh38)
Location 2:175373332-175373354
Sequence CTGATTACACAGATTGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942379439_942379443 -7 Left 942379439 2:175373332-175373354 CCTTAGTCAATCTGTGTAATCAG No data
Right 942379443 2:175373348-175373370 TAATCAGAGGCAGGAATTGTGGG No data
942379439_942379442 -8 Left 942379439 2:175373332-175373354 CCTTAGTCAATCTGTGTAATCAG No data
Right 942379442 2:175373347-175373369 GTAATCAGAGGCAGGAATTGTGG No data
942379439_942379445 8 Left 942379439 2:175373332-175373354 CCTTAGTCAATCTGTGTAATCAG No data
Right 942379445 2:175373363-175373385 ATTGTGGGTTGACCTTGCCAGGG No data
942379439_942379444 7 Left 942379439 2:175373332-175373354 CCTTAGTCAATCTGTGTAATCAG No data
Right 942379444 2:175373362-175373384 AATTGTGGGTTGACCTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942379439 Original CRISPR CTGATTACACAGATTGACTA AGG (reversed) Intergenic
No off target data available for this crispr