ID: 942384362

View in Genome Browser
Species Human (GRCh38)
Location 2:175425662-175425684
Sequence TCATCTCTGGAAGTTCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942384362_942384364 -7 Left 942384362 2:175425662-175425684 CCAAACTGAACTTCCAGAGATGA No data
Right 942384364 2:175425678-175425700 GAGATGAAAACTACAATGTCTGG 0: 2
1: 2
2: 7
3: 28
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942384362 Original CRISPR TCATCTCTGGAAGTTCAGTT TGG (reversed) Intergenic
No off target data available for this crispr