ID: 942385772

View in Genome Browser
Species Human (GRCh38)
Location 2:175441243-175441265
Sequence CCTCCCAAGCACCCTCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942385765_942385772 1 Left 942385765 2:175441219-175441241 CCTTTATTTTCTCTTCCCCCTCC No data
Right 942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG No data
942385763_942385772 10 Left 942385763 2:175441210-175441232 CCAAGCTTCCCTTTATTTTCTCT No data
Right 942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG No data
942385759_942385772 26 Left 942385759 2:175441194-175441216 CCCCAGCTCCTCAACTCCAAGCT No data
Right 942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG No data
942385757_942385772 28 Left 942385757 2:175441192-175441214 CCCCCCAGCTCCTCAACTCCAAG No data
Right 942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG No data
942385761_942385772 24 Left 942385761 2:175441196-175441218 CCAGCTCCTCAACTCCAAGCTTC No data
Right 942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG No data
942385760_942385772 25 Left 942385760 2:175441195-175441217 CCCAGCTCCTCAACTCCAAGCTT No data
Right 942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG No data
942385764_942385772 2 Left 942385764 2:175441218-175441240 CCCTTTATTTTCTCTTCCCCCTC No data
Right 942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG No data
942385758_942385772 27 Left 942385758 2:175441193-175441215 CCCCCAGCTCCTCAACTCCAAGC No data
Right 942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG No data
942385762_942385772 18 Left 942385762 2:175441202-175441224 CCTCAACTCCAAGCTTCCCTTTA No data
Right 942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942385772 Original CRISPR CCTCCCAAGCACCCTCCTTG TGG Intergenic
No off target data available for this crispr