ID: 942385874

View in Genome Browser
Species Human (GRCh38)
Location 2:175442202-175442224
Sequence TTACACAGCTGGGCATAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942385870_942385874 -6 Left 942385870 2:175442185-175442207 CCACGGCAGACAGAGCTTTACAC No data
Right 942385874 2:175442202-175442224 TTACACAGCTGGGCATAAACGGG No data
942385869_942385874 0 Left 942385869 2:175442179-175442201 CCAGGTCCACGGCAGACAGAGCT No data
Right 942385874 2:175442202-175442224 TTACACAGCTGGGCATAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942385874 Original CRISPR TTACACAGCTGGGCATAAAC GGG Intergenic
No off target data available for this crispr