ID: 942386723

View in Genome Browser
Species Human (GRCh38)
Location 2:175450720-175450742
Sequence CTGTTTGCAAAGATTTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942386717_942386723 20 Left 942386717 2:175450677-175450699 CCTGGATCCCATGACAGTGGGGG No data
Right 942386723 2:175450720-175450742 CTGTTTGCAAAGATTTAGATTGG No data
942386719_942386723 13 Left 942386719 2:175450684-175450706 CCCATGACAGTGGGGGTTTGTGA No data
Right 942386723 2:175450720-175450742 CTGTTTGCAAAGATTTAGATTGG No data
942386720_942386723 12 Left 942386720 2:175450685-175450707 CCATGACAGTGGGGGTTTGTGAA No data
Right 942386723 2:175450720-175450742 CTGTTTGCAAAGATTTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942386723 Original CRISPR CTGTTTGCAAAGATTTAGAT TGG Intergenic
No off target data available for this crispr