ID: 942392605

View in Genome Browser
Species Human (GRCh38)
Location 2:175511311-175511333
Sequence TGTCACTGCACTACAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942392602_942392605 10 Left 942392602 2:175511278-175511300 CCAGGAGTTCAGGGCTACATTGA No data
Right 942392605 2:175511311-175511333 TGTCACTGCACTACAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942392605 Original CRISPR TGTCACTGCACTACAGTGGC AGG Intergenic
No off target data available for this crispr