ID: 942393058

View in Genome Browser
Species Human (GRCh38)
Location 2:175516500-175516522
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942393055_942393058 7 Left 942393055 2:175516470-175516492 CCACTGAATTCTTGAATCACCAG No data
Right 942393058 2:175516500-175516522 CTGTAGCCCTCCATTACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr