ID: 942393990

View in Genome Browser
Species Human (GRCh38)
Location 2:175526890-175526912
Sequence TGGCTGTACTAGGTGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942393990_942393995 27 Left 942393990 2:175526890-175526912 CCTTGTACCACCTAGTACAGCCA No data
Right 942393995 2:175526940-175526962 CCCCATGCTCCGTGCTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942393990 Original CRISPR TGGCTGTACTAGGTGGTACA AGG (reversed) Intergenic
No off target data available for this crispr