ID: 942394167

View in Genome Browser
Species Human (GRCh38)
Location 2:175528655-175528677
Sequence ACTTGGAGGCTTTTTTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942394164_942394167 -4 Left 942394164 2:175528636-175528658 CCTTTTGTCAAAAATAAAGACTT No data
Right 942394167 2:175528655-175528677 ACTTGGAGGCTTTTTTCTTTTGG No data
942394163_942394167 0 Left 942394163 2:175528632-175528654 CCATCCTTTTGTCAAAAATAAAG No data
Right 942394167 2:175528655-175528677 ACTTGGAGGCTTTTTTCTTTTGG No data
942394162_942394167 1 Left 942394162 2:175528631-175528653 CCCATCCTTTTGTCAAAAATAAA No data
Right 942394167 2:175528655-175528677 ACTTGGAGGCTTTTTTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942394167 Original CRISPR ACTTGGAGGCTTTTTTCTTT TGG Intergenic
No off target data available for this crispr