ID: 942397657

View in Genome Browser
Species Human (GRCh38)
Location 2:175568599-175568621
Sequence TGAAAATTACAGCTGATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942397656_942397657 -2 Left 942397656 2:175568578-175568600 CCTGTCAGACAGCATCAGAGCTG No data
Right 942397657 2:175568599-175568621 TGAAAATTACAGCTGATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942397657 Original CRISPR TGAAAATTACAGCTGATTAA AGG Intergenic
No off target data available for this crispr