ID: 942399063

View in Genome Browser
Species Human (GRCh38)
Location 2:175581702-175581724
Sequence TTTCCATCAGTCATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942399055_942399063 29 Left 942399055 2:175581650-175581672 CCCACATTCACCTTGCCCTGGCT No data
Right 942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG No data
942399061_942399063 13 Left 942399061 2:175581666-175581688 CCTGGCTACACAGCAGGTTTGGA No data
Right 942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG No data
942399059_942399063 14 Left 942399059 2:175581665-175581687 CCCTGGCTACACAGCAGGTTTGG No data
Right 942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG No data
942399056_942399063 28 Left 942399056 2:175581651-175581673 CCACATTCACCTTGCCCTGGCTA No data
Right 942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG No data
942399054_942399063 30 Left 942399054 2:175581649-175581671 CCCCACATTCACCTTGCCCTGGC No data
Right 942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG No data
942399057_942399063 19 Left 942399057 2:175581660-175581682 CCTTGCCCTGGCTACACAGCAGG No data
Right 942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942399063 Original CRISPR TTTCCATCAGTCATGGAAAA TGG Intergenic
No off target data available for this crispr