ID: 942403422

View in Genome Browser
Species Human (GRCh38)
Location 2:175627639-175627661
Sequence ATCCCCTTCATCCAAGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942403422_942403427 11 Left 942403422 2:175627639-175627661 CCTTTAACTTGGATGAAGGGGAT No data
Right 942403427 2:175627673-175627695 CAAGCATCTGAATCATTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942403422 Original CRISPR ATCCCCTTCATCCAAGTTAA AGG (reversed) Intergenic