ID: 942403422 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:175627639-175627661 |
| Sequence | ATCCCCTTCATCCAAGTTAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942403422_942403427 | 11 | Left | 942403422 | 2:175627639-175627661 | CCTTTAACTTGGATGAAGGGGAT | No data | ||
| Right | 942403427 | 2:175627673-175627695 | CAAGCATCTGAATCATTCAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942403422 | Original CRISPR | ATCCCCTTCATCCAAGTTAA AGG (reversed) | Intergenic | ||