ID: 942403584

View in Genome Browser
Species Human (GRCh38)
Location 2:175629466-175629488
Sequence GTTTGTAATTCCCTTTCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942403581_942403584 13 Left 942403581 2:175629430-175629452 CCTCACGAAACCAAACCAAAACA No data
Right 942403584 2:175629466-175629488 GTTTGTAATTCCCTTTCTACAGG No data
942403583_942403584 -2 Left 942403583 2:175629445-175629467 CCAAAACAGAACAAACAAAACGT No data
Right 942403584 2:175629466-175629488 GTTTGTAATTCCCTTTCTACAGG No data
942403582_942403584 3 Left 942403582 2:175629440-175629462 CCAAACCAAAACAGAACAAACAA No data
Right 942403584 2:175629466-175629488 GTTTGTAATTCCCTTTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942403584 Original CRISPR GTTTGTAATTCCCTTTCTAC AGG Intergenic
No off target data available for this crispr