ID: 942404540

View in Genome Browser
Species Human (GRCh38)
Location 2:175640229-175640251
Sequence CAACTGCATCATAATTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942404538_942404540 19 Left 942404538 2:175640187-175640209 CCACTAAAGCACGGTTTCTCTAA No data
Right 942404540 2:175640229-175640251 CAACTGCATCATAATTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942404540 Original CRISPR CAACTGCATCATAATTACCC AGG Intergenic
No off target data available for this crispr