ID: 942406914

View in Genome Browser
Species Human (GRCh38)
Location 2:175665898-175665920
Sequence ATAACACCTCTGGTCAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942406912_942406914 8 Left 942406912 2:175665867-175665889 CCATGTAGTAAAGTGACACTGAA No data
Right 942406914 2:175665898-175665920 ATAACACCTCTGGTCAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942406914 Original CRISPR ATAACACCTCTGGTCAAATA TGG Intergenic
No off target data available for this crispr