ID: 942408898

View in Genome Browser
Species Human (GRCh38)
Location 2:175685866-175685888
Sequence GTGCTGTGCTAGGTGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942408898_942408905 -7 Left 942408898 2:175685866-175685888 CCATGTCCCACCTAGCACAGCAC No data
Right 942408905 2:175685882-175685904 ACAGCACCAAGCCTGGGAGGTGG No data
942408898_942408906 -3 Left 942408898 2:175685866-175685888 CCATGTCCCACCTAGCACAGCAC No data
Right 942408906 2:175685886-175685908 CACCAAGCCTGGGAGGTGGCTGG No data
942408898_942408904 -10 Left 942408898 2:175685866-175685888 CCATGTCCCACCTAGCACAGCAC No data
Right 942408904 2:175685879-175685901 AGCACAGCACCAAGCCTGGGAGG No data
942408898_942408910 26 Left 942408898 2:175685866-175685888 CCATGTCCCACCTAGCACAGCAC No data
Right 942408910 2:175685915-175685937 TTCATAATGGCATTGCAAGTAGG No data
942408898_942408909 13 Left 942408898 2:175685866-175685888 CCATGTCCCACCTAGCACAGCAC No data
Right 942408909 2:175685902-175685924 TGGCTGGCAGAGCTTCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942408898 Original CRISPR GTGCTGTGCTAGGTGGGACA TGG (reversed) Intergenic
No off target data available for this crispr