ID: 942408904

View in Genome Browser
Species Human (GRCh38)
Location 2:175685879-175685901
Sequence AGCACAGCACCAAGCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942408893_942408904 23 Left 942408893 2:175685833-175685855 CCCCTTGATGAGACCAATGTCTC No data
Right 942408904 2:175685879-175685901 AGCACAGCACCAAGCCTGGGAGG No data
942408897_942408904 -7 Left 942408897 2:175685863-175685885 CCACCATGTCCCACCTAGCACAG No data
Right 942408904 2:175685879-175685901 AGCACAGCACCAAGCCTGGGAGG No data
942408898_942408904 -10 Left 942408898 2:175685866-175685888 CCATGTCCCACCTAGCACAGCAC No data
Right 942408904 2:175685879-175685901 AGCACAGCACCAAGCCTGGGAGG No data
942408895_942408904 21 Left 942408895 2:175685835-175685857 CCTTGATGAGACCAATGTCTCTT No data
Right 942408904 2:175685879-175685901 AGCACAGCACCAAGCCTGGGAGG No data
942408894_942408904 22 Left 942408894 2:175685834-175685856 CCCTTGATGAGACCAATGTCTCT No data
Right 942408904 2:175685879-175685901 AGCACAGCACCAAGCCTGGGAGG No data
942408896_942408904 10 Left 942408896 2:175685846-175685868 CCAATGTCTCTTGACTTCCACCA No data
Right 942408904 2:175685879-175685901 AGCACAGCACCAAGCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942408904 Original CRISPR AGCACAGCACCAAGCCTGGG AGG Intergenic
No off target data available for this crispr