ID: 942408906

View in Genome Browser
Species Human (GRCh38)
Location 2:175685886-175685908
Sequence CACCAAGCCTGGGAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942408900_942408906 -10 Left 942408900 2:175685873-175685895 CCACCTAGCACAGCACCAAGCCT No data
Right 942408906 2:175685886-175685908 CACCAAGCCTGGGAGGTGGCTGG No data
942408894_942408906 29 Left 942408894 2:175685834-175685856 CCCTTGATGAGACCAATGTCTCT No data
Right 942408906 2:175685886-175685908 CACCAAGCCTGGGAGGTGGCTGG No data
942408897_942408906 0 Left 942408897 2:175685863-175685885 CCACCATGTCCCACCTAGCACAG No data
Right 942408906 2:175685886-175685908 CACCAAGCCTGGGAGGTGGCTGG No data
942408893_942408906 30 Left 942408893 2:175685833-175685855 CCCCTTGATGAGACCAATGTCTC No data
Right 942408906 2:175685886-175685908 CACCAAGCCTGGGAGGTGGCTGG No data
942408899_942408906 -9 Left 942408899 2:175685872-175685894 CCCACCTAGCACAGCACCAAGCC No data
Right 942408906 2:175685886-175685908 CACCAAGCCTGGGAGGTGGCTGG No data
942408895_942408906 28 Left 942408895 2:175685835-175685857 CCTTGATGAGACCAATGTCTCTT No data
Right 942408906 2:175685886-175685908 CACCAAGCCTGGGAGGTGGCTGG No data
942408898_942408906 -3 Left 942408898 2:175685866-175685888 CCATGTCCCACCTAGCACAGCAC No data
Right 942408906 2:175685886-175685908 CACCAAGCCTGGGAGGTGGCTGG No data
942408896_942408906 17 Left 942408896 2:175685846-175685868 CCAATGTCTCTTGACTTCCACCA No data
Right 942408906 2:175685886-175685908 CACCAAGCCTGGGAGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942408906 Original CRISPR CACCAAGCCTGGGAGGTGGC TGG Intergenic
No off target data available for this crispr