ID: 942408909

View in Genome Browser
Species Human (GRCh38)
Location 2:175685902-175685924
Sequence TGGCTGGCAGAGCTTCATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942408897_942408909 16 Left 942408897 2:175685863-175685885 CCACCATGTCCCACCTAGCACAG No data
Right 942408909 2:175685902-175685924 TGGCTGGCAGAGCTTCATAATGG No data
942408898_942408909 13 Left 942408898 2:175685866-175685888 CCATGTCCCACCTAGCACAGCAC No data
Right 942408909 2:175685902-175685924 TGGCTGGCAGAGCTTCATAATGG No data
942408900_942408909 6 Left 942408900 2:175685873-175685895 CCACCTAGCACAGCACCAAGCCT No data
Right 942408909 2:175685902-175685924 TGGCTGGCAGAGCTTCATAATGG No data
942408907_942408909 -9 Left 942408907 2:175685888-175685910 CCAAGCCTGGGAGGTGGCTGGCA No data
Right 942408909 2:175685902-175685924 TGGCTGGCAGAGCTTCATAATGG No data
942408899_942408909 7 Left 942408899 2:175685872-175685894 CCCACCTAGCACAGCACCAAGCC No data
Right 942408909 2:175685902-175685924 TGGCTGGCAGAGCTTCATAATGG No data
942408902_942408909 3 Left 942408902 2:175685876-175685898 CCTAGCACAGCACCAAGCCTGGG No data
Right 942408909 2:175685902-175685924 TGGCTGGCAGAGCTTCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942408909 Original CRISPR TGGCTGGCAGAGCTTCATAA TGG Intergenic
No off target data available for this crispr