ID: 942408910

View in Genome Browser
Species Human (GRCh38)
Location 2:175685915-175685937
Sequence TTCATAATGGCATTGCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942408898_942408910 26 Left 942408898 2:175685866-175685888 CCATGTCCCACCTAGCACAGCAC No data
Right 942408910 2:175685915-175685937 TTCATAATGGCATTGCAAGTAGG No data
942408902_942408910 16 Left 942408902 2:175685876-175685898 CCTAGCACAGCACCAAGCCTGGG No data
Right 942408910 2:175685915-175685937 TTCATAATGGCATTGCAAGTAGG No data
942408908_942408910 -1 Left 942408908 2:175685893-175685915 CCTGGGAGGTGGCTGGCAGAGCT No data
Right 942408910 2:175685915-175685937 TTCATAATGGCATTGCAAGTAGG No data
942408897_942408910 29 Left 942408897 2:175685863-175685885 CCACCATGTCCCACCTAGCACAG No data
Right 942408910 2:175685915-175685937 TTCATAATGGCATTGCAAGTAGG No data
942408899_942408910 20 Left 942408899 2:175685872-175685894 CCCACCTAGCACAGCACCAAGCC No data
Right 942408910 2:175685915-175685937 TTCATAATGGCATTGCAAGTAGG No data
942408907_942408910 4 Left 942408907 2:175685888-175685910 CCAAGCCTGGGAGGTGGCTGGCA No data
Right 942408910 2:175685915-175685937 TTCATAATGGCATTGCAAGTAGG No data
942408900_942408910 19 Left 942408900 2:175685873-175685895 CCACCTAGCACAGCACCAAGCCT No data
Right 942408910 2:175685915-175685937 TTCATAATGGCATTGCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942408910 Original CRISPR TTCATAATGGCATTGCAAGT AGG Intergenic
No off target data available for this crispr