ID: 942414568

View in Genome Browser
Species Human (GRCh38)
Location 2:175745402-175745424
Sequence TGGGCTCTGCTCAAGCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942414565_942414568 -9 Left 942414565 2:175745388-175745410 CCACTGGTCCTATCTGGGCTCTG No data
Right 942414568 2:175745402-175745424 TGGGCTCTGCTCAAGCTAGGTGG No data
942414561_942414568 0 Left 942414561 2:175745379-175745401 CCTGAGGACCCACTGGTCCTATC No data
Right 942414568 2:175745402-175745424 TGGGCTCTGCTCAAGCTAGGTGG No data
942414564_942414568 -8 Left 942414564 2:175745387-175745409 CCCACTGGTCCTATCTGGGCTCT No data
Right 942414568 2:175745402-175745424 TGGGCTCTGCTCAAGCTAGGTGG No data
942414560_942414568 1 Left 942414560 2:175745378-175745400 CCCTGAGGACCCACTGGTCCTAT No data
Right 942414568 2:175745402-175745424 TGGGCTCTGCTCAAGCTAGGTGG No data
942414559_942414568 5 Left 942414559 2:175745374-175745396 CCAGCCCTGAGGACCCACTGGTC No data
Right 942414568 2:175745402-175745424 TGGGCTCTGCTCAAGCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942414568 Original CRISPR TGGGCTCTGCTCAAGCTAGG TGG Intergenic
No off target data available for this crispr