ID: 942417027

View in Genome Browser
Species Human (GRCh38)
Location 2:175770210-175770232
Sequence TAAATGGCCACACGTTGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942417027_942417032 3 Left 942417027 2:175770210-175770232 CCTACTCAACGTGTGGCCATTTA No data
Right 942417032 2:175770236-175770258 ATATGTTACAGGTCAAAGACAGG No data
942417027_942417028 -8 Left 942417027 2:175770210-175770232 CCTACTCAACGTGTGGCCATTTA No data
Right 942417028 2:175770225-175770247 GCCATTTACCCATATGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942417027 Original CRISPR TAAATGGCCACACGTTGAGT AGG (reversed) Intergenic
No off target data available for this crispr